NEET UG 2024 · Biology · 100 questions

NEET 2024 Biology, question by question

The NEET 2024 Biology section had 100 questions from 32 chapters: 55 easy, 45 medium and 0 hard. 55% were easy, 6 points below the 2017–2026 average for Biology, and 48 (48%) came from Class 12. Biomolecules had the most, 6 questions.

Updated 2026-10-08

Questions: 100; 50% of the paper
Chapters asked: 32; 0 usual chapters skipped
Easy: 55%; 2017–2026 average 61%
From Class 12: 48%; 2017–2026 average 49%

The section

What Biology asked in 2024

Class balance, difficulty and the form of the questions. Bars below compare Biology across every paper from 2017–2026.

Botany and Zoology

5050

Botany
Zoology

Class 11 and 12

5248

Class 11
Class 12

Difficulty

5545

Easy
Medium
Hard

New ideas: 57 (57%)
Use a figure: 7

Question pattern

BIOLOGY 2024

Match the lists30%
Recall30%
Concept16%
Two statements10%
Figure-based7%
Application3%
Assertion–reason2%
Calculation2%

Chapters

The 2024 Biology chapter split

All 32 Biology chapters asked, and which got more or less than usual: the chapter’s ten-year average per 180 questions. Counts are scaled to 180 questions so years compare fairly.

Every chapter asked

Biomolecules6 · usually 3.1
Human Health and Disease6 · usually 3.2
Molecular Basis of Inheritance6 · usually 5.8
Principles of Inheritance and Variation6 · usually 4.1
Biodiversity and Conservation5 · usually 2.1
Biotechnology: Principles and Processes5 · usually 4.4
Animal Kingdom4 · usually 3.3
Cell Cycle and Cell Division4 · usually 3.0
Cell: The Unit of Life4 · usually 3.5
Evolution4 · usually 2.7
Morphology of Flowering Plants4 · usually 2.7
Structural Organisation in Animals4 · usually 2.6
Anatomy of Flowering Plants3 · usually 2.4
Chemical Coordination and Integration3 · usually 2.3
Human Reproduction3 · usually 3.2
Photosynthesis in Higher Plants3 · usually 2.2
Plant Growth and Development3 · usually 2.2
Sexual Reproduction in Flowering Plants3 · usually 3.6
Biological Classification2 · usually 2.5
Biotechnology and its Applications2 · usually 2.3
Body Fluids and Circulation2 · usually 2.0
Breathing and Exchange of Gases2 · usually 1.6
Excretory Products and their Elimination2 · usually 1.5
Neural Control and Coordination2 · usually 1.5
Organisms and Populations2 · usually 3.0
Reproductive Health2 · usually 2.1
Respiration in Plants2 · usually 1.4
Strategies for Enhancement in Food Production2 · usually 1.0
Ecosystem1 · usually 1.9
Locomotion and Movement1 · usually 1.8
Microbes in Human Welfare1 · usually 1.6
Plant Kingdom1 · usually 3.0

More than usual

Biodiversity and Conservation+2.45 questions · usually 2.1
Biomolecules+2.36 questions · usually 3.1
Human Health and Disease+2.26 questions · usually 3.2
Principles of Inheritance and Variation+1.36 questions · usually 4.1
Structural Organisation in Animals+1.04 questions · usually 2.6
Morphology of Flowering Plants+0.94 questions · usually 2.7
Evolution+0.94 questions · usually 2.7
Strategies for Enhancement in Food Production+0.82 questions · usually 1.0

Less than usual, or skipped

Plant Kingdom−2.11 question · usually 3.0
Organisms and Populations−1.22 questions · usually 3.0
Ecosystem−1.01 question · usually 1.9
Locomotion and Movement−0.91 question · usually 1.8
Sexual Reproduction in Flowering Plants−0.93 questions · usually 3.6
Biological Classification−0.82 questions · usually 2.5
Microbes in Human Welfare−0.71 question · usually 1.6
Human Reproduction−0.53 questions · usually 3.2

Every question

All 100 Biology questions of NEET 2024

Open any question for the full text, the options and the official answer. “New idea” means no earlier paper had tested it.

Subject

Difficulty

Idea

Find

100 of 100 questions

Botany50 questions

28 easy22 medium0 hard

Q101
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Molecular Basis of Inheritance Gene Regulation and the lac Operon lac z, y and a Gene Products
MediumOne-line MCQIdea asked in 3 papersAsked the year before
Q102
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a)…
Morphology of Flowering Plants Flower Structure Ovary Position and Whorls
MediumFigure-basedNew idea
Q103
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they…
Biodiversity and Conservation Conservation Strategies Ex-situ Conservation Definition
EasyOne-line MCQNew idea
Q104
Formation of interfascicular cambium from fully developed parenchyma cells is an example for
Plant Growth and Development Plant Growth and Differentiation Dedifferentiation and Redifferentiation
EasyOne-line MCQIdea asked in 3 papersAsked the year before
Q105
Which of the following is an example of actinomorphic flower?
Morphology of Flowering Plants Flower Structure Actinomorphic Flower Examples
EasyOne-line MCQNew idea
Q106
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
Biotechnology: Principles and Processes Restriction Enzymes Hind II Cleavage Pattern
EasyOne-line MCQNew idea
Q107
Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO $_2$ D. ATP E. NADPH Choose the…
Photosynthesis in Higher Plants Calvin and Hatch-Slack Cycles C3 Reduction and Regen
EasyOtherNew idea
Q108
Match List I with List II List I | List II A. $Rhizopus$ | I. Mushroom B. $Ustilago$ | II. Smut fungus C. $Puccinia$ | III. Bread mould D.…
Biological Classification Kingdom Fungi Fungal Genera Classification
EasyMatch the listsNew idea
Q109
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Biomolecules Biomolecule Structure Phospholipid Structure and Lecithin
EasyOne-line MCQNew idea
Q110
The capacity to generate a whole plant from any cell of the plant is called:
Strategies for Enhancement in Food Production Plant and Animal Breeding Totipotency and Tissue Culture
EasyOne-line MCQNew idea
Q111
Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.…
Cell Cycle and Cell Division Meiotic Prophase I Chiasmata Formation
MediumTwo statementsIdea asked in 2 papers
Q112
How many molecules of ATP and NADPH are required for every molecule of CO $_2$ fixed in the Calvin cycle?
Photosynthesis in Higher Plants Calvin and Hatch-Slack Cycles C3 Reduction and Regen
EasyOne-line MCQNew idea
Q113
Match List I with List II List I | List II A. Two or more alternative forms of a gene | I. Back cross B. Cross of F $_1$ progeny with…
Principles of Inheritance and Variation Mendelian Inheritance Back Cross vs Test Cross
EasyMatch the listsNew idea
Q114
List of endangered species was released by-
Biodiversity and Conservation Conservation Strategies IUCN Red List Categories
EasyOne-line MCQNew idea
Q115
The equation of Verhulst-Pearl logistic growth is $\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right]$ . From this equation, $K$ indicates:
Organisms and Populations Population Attributes Carrying Capacity (K)
EasyOne-line MCQNew idea
Q116
Identify the set of correct statements: A. The flowers of $Vallisneria$ are colourful and produce nectar. B. The flowers of waterlily are…
Sexual Reproduction in Flowering Plants Pollination Mechanisms Hydrophily Mechanisms and Traps
MediumOtherNew idea
Q117
Bulliform cells are responsible for
Anatomy of Flowering Plants Plant Tissues and Anatomy Isobilateral Leaf and Bulliform Cells
MediumOne-line MCQIdea asked in 2 papers
Q118
Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and…
Principles of Inheritance and Variation Mendelian Inheritance Law of Dominance Postulates
MediumOtherNew idea
Q119
The cofactor of the enzyme carboxypeptidase is:
Biomolecules Biomolecule Structure Enzyme Prosthetic Groups
EasyOne-line MCQIdea asked in 3 papers
Q120
Which one of the following is not a criterion for classification of fungi?
Biological Classification Kingdom Fungi Mycelium Morphology
EasyOne-line MCQNew idea
Q121
Match List I with List II List I | List II A. Nucleolus | I. Site of formation of glycolipid B. Centriole | II. Organization like the…
Cell: The Unit of Life Nuclear Organization Nucleolus and rRNA Synthesis
MediumMatch the listsIdea asked in 2 papers
Q122
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
Sexual Reproduction in Flowering Plants Embryo Development Grass Embryo Diagram Labeling
MediumFigure-basedNew idea
Q123
In the given figure, which component has thin outer walls and highly thickened inner walls?
Anatomy of Flowering Plants Plant Tissues and Anatomy Epidermal, Ground and Vascular Tissue Systems
EasyFigure-basedIdea asked in 2 papers
Q124
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
Molecular Basis of Inheritance Transcription Process Transcription Unit Parts
EasyOne-line MCQNew idea
Q125
Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem…
Anatomy of Flowering Plants Plant Tissues and Anatomy Parenchyma, Collenchyma and Sclerenchyma
MediumTwo statementsIdea asked in 3 papers
Q126
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
Principles of Inheritance and Variation Mendelian Inheritance Examples of Incomplete Dominance
MediumOne-line MCQNew idea
Q127
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
Biomolecules Biomolecule Structure Temperature and Competitive Inhibition
EasyOne-line MCQIdea asked in 2 papersAsked the year before
Q128
Match List I with List II List I | List II A. $Clostridium$ $butylicum$ | I. Ethanol B. $Saccharomyces$ $cerevisiae$ | II. Streptokinase…
Microbes in Human Welfare Microbe-Product Matching
MediumMatch the listsIdea asked in 5 papers
Q129
Spindle fibers attach to kinetochores of chromosomes during
Cell Cycle and Cell Division Mitotic Division Kinetochore Structure and Function
EasyOne-line MCQIdea asked in 2 papers
Q130
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
Plant Growth and Development Plant Growth Regulators 2,4-D as a Dicot Herbicide
EasyOne-line MCQNew ideaIdea asked in 2 papers
Q131
Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions…
Biodiversity and Conservation Patterns and Estimates of Biodiversity Latitudinal Gradient of Diversity
MediumOtherNew idea
Q132
Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene $cry$ IAc. Statement II : Bt toxin…
Biotechnology and its Applications Transgenic Plants Specific Cry Gene Targets
MediumTwo statementsNew idea
Q133
What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would…
Biotechnology: Principles and Processes Cloning Vectors Origin of Replication (ori)
MediumOtherIdea asked in 3 papers
Q134
These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and…
Biodiversity and Conservation Biodiversity Loss Components of the Evil Quartet
EasyOtherIdea asked in 2 papers
Q135
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant,…
Principles of Inheritance and Variation Mendelian Inheritance Test Cross Application
EasyOne-line MCQNew idea
Q136
Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs…
Plant Kingdom Algae Classification Phaeophyceae Structure
MediumOtherNew idea
Q137
Match List I with List II List I (Types of Stamens) | List II (Example) A. Monoadelphous | I. Citrus B. Diadelphous | II. Pea C.…
Morphology of Flowering Plants Flower Structure Cohesion of Stamens
MediumMatch the listsNew idea
Q138
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
Plant Growth and Development Plant Growth Regulators Gibberellins in Sugarcane Production
EasyOne-line MCQIdea asked in 2 papers
Q139
Identify the correct description about the given figure:
Sexual Reproduction in Flowering Plants Pollination Mechanisms Inflorescence Adaptation in Wind Pollination
EasyFigure-basedNew idea
Q140
Which of the following are fused in somatic hybridization involving two varieties of plants?
Strategies for Enhancement in Food Production Plant and Animal Breeding Somatic Hybridisation
EasyOne-line MCQNew idea
Q141
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
Respiration in Plants TCA Cycle GTP/ATP Synthesis
MediumOne-line MCQIdea asked in 2 papers
Q142
Match List I with List II List I | List II A. Robert May | I. Species-Area relationship B. Alexander von Humboldt | II. Long term…
Biodiversity and Conservation Patterns and Estimates of Biodiversity Scientists and Biodiversity Concepts
MediumMatch the listsNew idea
Q143
Match List I with List II List I | List II A. Rose | I. Twisted aestivation B. Pea | II. Perigynous flower C. Cotton | III. Drupe D. Mango…
Morphology of Flowering Plants Flower Structure Marginal Placentation Example
MediumMatch the listsNew idea
Q144
Match List I with List II List I | List II A. GLUT-4 | I. Hormone B. Insulin | II. Enzyme C. Trypsin | III. Intercellular ground substance…
Biomolecules Biomolecule Structure Function of GLUT-4
MediumMatch the listsNew ideaIdea asked in 2 papers
Q145
The DNA present in chloroplast is:
Cell: The Unit of Life Mitochondria and Plastids Chloroplast DNA Characteristics
EasyOne-line MCQNew idea
Q146
Given below are two statements: Statement I : In C $_3$ plants, some O $_2$ binds to RuBisCO, hence CO $_2$ fixation is decreased. Statement…
Photosynthesis in Higher Plants Calvin and Hatch-Slack Cycles Photorespiration (C2)
MediumTwo statementsNew idea
Q147
Which of the following statement is correct regarding the process of replication in $E.coli$ ?
Molecular Basis of Inheritance DNA Replication Polymerase Directionality
EasyOne-line MCQNew idea
Q148
Match List I with List II List I | List II A. Frederick Griffith | I. Genetic code B. Francois Jacob & Jacque Monod | II.…
Molecular Basis of Inheritance DNA Replication Semi-conservative Model
EasyMatch the listsIdea asked in 2 papers
Q149
Match List I with List II List-I | List-II A. Citric acid cycle | I. Cytoplasm B. Glycolysis | II. Mitochondrial matrix C. Electron…
Respiration in Plants Glycolysis Pathway Glycolysis Site and Substrate
EasyMatch the listsNew idea
Q150
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m $^{-2}$ ) yr $^{-1}$ , what would be the GPP…
Ecosystem Energy Flow in Ecosystem Lindeman's 10 Percent Law
MediumNumericalNew idea

Zoology50 questions

27 easy23 medium0 hard

Q151
Match List I with List II List-I | List-II A. Fibrous joints | I. Adjacent vertebrae, limited movement B. Cartilaginous joints | II.…
Locomotion and Movement Skeletal Joints Fibrous Joints
EasyMatch the listsIdea asked in 2 papers
Q152
Match List I with List II List-I | List-II A. Typhoid | I. Fungus B. Leishmaniasis | II. Nematode C. Ringworm | III. Protozoa D.…
Human Health and Disease Human Diseases, Cancer and Drug Abuse Diseases and Their Pathogens
EasyMatch the listsIdea asked in 5 papersAsked the year before
Q153
In both sexes of cockroach, a pair of filamentous structures called anal cerci are on:
Structural Organisation in Animals Cockroach Anatomy Anal Cerci Segment Origin
EasyOne-line MCQNew idea
Q154
Which of the following is not a component of Fallopian tube?
Human Reproduction Female Reproductive System Fallopian Tube Anatomy
EasyOne-line MCQNew idea
Q155
Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The…
Human Reproduction Female Reproductive System Hymen Characteristics
EasyTwo statementsNew idea
Q156
Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic…
Human Health and Disease Immunity and Lymphoid Organs Autoimmune Disorders
MediumOtherIdea asked in 3 papers
Q157
Match List I with List II List-I (Sub Phases of Prophase I) | List-II (Specific Characters) A. Diakinesis | I. Synaptonemal complex…
Cell Cycle and Cell Division Meiotic Prophase I Sequence of Prophase I Stages
EasyMatch the listsIdea asked in 2 papers
Q158
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo…
Evolution Origin of Life and Human Evolution Sequence of Human Evolution
EasyOtherNew idea
Q159
Match List I with List II List-I | List-II A. Expiratory capacity | I. Expiratory reserve volume + Tidal volume + Inspiratory reserve…
Breathing and Exchange of Gases Mechanism of Breathing Pulmonary Capacities
EasyMatch the listsIdea asked in 3 papersAsked the year before
Q160
Match List I with List II List-I | List-II A. Pons | I. Provides additional space for Neurons, regulates posture and balance. B.…
Neural Control and Coordination Neural System and Brain Midbrain, Hindbrain and Brain Stem
EasyMatch the listsNew idea
Q161
Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to…
Excretory Products and their Elimination Urine Formation Descending Limb Permeability
MediumTwo statementsNew ideaIdea asked in 2 papers
Q162
Which of the following is not a steroid hormone?
Chemical Coordination and Integration Endocrine Glands and Hormone Action Chemical Classes of Hormones
EasyOne-line MCQIdea asked in 3 papers
Q163
Match List I with List II List-I | List-II A. Pterophyllum | I. Hag fish B. Myxine | II. Saw fish C. Pristis | III. Angel fish D.…
Animal Kingdom Chordate Classes Comparison of Fish Classes
MediumMatch the listsIdea asked in 2 papers
Q164
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Molecular Basis of Inheritance Transcription Process Predicting mRNA from Template Strand
EasyOne-line MCQNew idea
Q165
Which of the following statements is incorrect?
Biotechnology: Principles and Processes Cloning Vectors Bioreactors
MediumOne-line MCQIdea asked in 3 papers
Q166
Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body: Name of…
Structural Organisation in Animals Animal Tissues Muscle Tissue Classification
EasyFigure-basedNew idea
Q167
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Evolution Natural Selection Factors Disturbing Hardy-Weinberg Equilibrium
MediumOne-line MCQNew idea
Q168
Which of the following is not a natural/traditional contraceptive method?
Reproductive Health Contraceptive Methods Natural Contraceptive Methods
EasyOne-line MCQNew idea
Q169
The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:
Biotechnology: Principles and Processes Cloning Vectors Origin of Replication (ori)
MediumFigure-basedIdea asked in 3 papers
Q170
Match List I with List II List-I | List-II A. Lipase | I. Peptide bond B. Nuclease | II. Ester bond C. Protease | III. Glycosidic bond D.…
Biomolecules Biomolecule Structure Peptide Bond Formation
EasyMatch the listsIdea asked in 2 papers
Q171
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
Breathing and Exchange of Gases Oxygen Dissociation Curve Alveolar Conditions for Oxyhemoglobin
EasyOne-line MCQIdea asked in 3 papers
Q172
Match List I with List II List-I | List-II A. Common cold | I. Plasmodium B. Haemozoin | II. Typhoid C. Widal test | III. Rhinoviruses D.…
Human Health and Disease Human Diseases, Cancer and Drug Abuse Diseases and Their Pathogens
MediumMatch the listsIdea asked in 5 papersAsked the year before
Q173
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Breast-feeding during…
Human Health and Disease Immunity and Lymphoid Organs Colostrum and IgA
EasyAssertion–reasonIdea asked in 3 papers
Q174
Match List I with List II List-I | List-II A. Non-medicated IUD | I. Multiload 375 B. Copper releasing IUD | II. Progestogens C. Hormone…
Reproductive Health Contraceptive Methods IUD Classifications
EasyMatch the listsIdea asked in 3 papers
Q175
Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the…
Cell Cycle and Cell Division Mitotic Division Sequence of Cell Cycle Phases
EasyOtherIdea asked in 3 papers
Q176
Match List I with List II List-I | List-II A. Pleurobrachia | I. Mollusca B. Radula | II. Ctenophora C. Stomochord | III. Osteichthyes D.…
Animal Kingdom Animal Kingdom: Basis of Classification and Non-chordates Distinctive Structures of Phyla
MediumMatch the listsIdea asked in 4 papers
Q177
The flippers of the Penguins and Dolphins are the example of the:
Evolution Evidence for Evolution Analogous Organs in Animals
EasyOne-line MCQIdea asked in 2 papers
Q178
Match List I with List II List-I | List-II A. Axoneme | I. Centriole B. Cartwheel pattern | II. Cilia and flagella C. Crista | III.…
Cell: The Unit of Life Ribosomes and Cytoskeleton Cilia and Flagella Structure
EasyMatch the listsNew idea
Q179
Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D.…
Body Fluids and Circulation Cardiac Cycle Bundle of His Electrical Isolation
EasyOtherNew idea
Q180
The 'Ti plasmid' of Agrobacterium tumefaciens stands for:
Biotechnology: Principles and Processes Cloning Vectors Ti Plasmid and T-DNA
EasyOne-line MCQIdea asked in 2 papers
Q181
Match List I with List II List-I | List-II A. Cocaine | I. Effective sedative in surgery B. Heroin | II. Cannabis sativa C. Morphine |…
Human Health and Disease Human Diseases, Cancer and Drug Abuse Drugs: Sources and Effects
MediumMatch the listsIdea asked in 2 papersAsked the year before
Q182
Match List I with List II List-I | List-II A. Down's syndrome | I. 11th chromosome B. α-Thalassaemia | II. 'X' chromosome C.…
Principles of Inheritance and Variation Sex Determination and Genetic Disorders Mendelian Disorders and Their Loci
MediumMatch the listsIdea asked in 2 papers
Q183
Match List I with List II List-I | List-II A. α-1 antitrypsin | I. Cotton bollworm B. Cry IAb | II. ADA deficiency C. Cry IAc | III.…
Biotechnology and its Applications Transgenic Plants Specific Cry Gene Targets
MediumMatch the listsNew idea
Q184
Consider the following statements: A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D.…
Animal Kingdom Animal Kingdom: Basis of Classification and Non-chordates Acoelomate, Pseudocoelomate and Coelomate
EasyOtherNew ideaIdea asked in 2 papers
Q185
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian…
Chemical Coordination and Integration Endocrine Glands and Hormone Action Pituitary Gland
MediumAssertion–reasonNew ideaIdea asked in 3 papers
Q186
Given below are two statements: Statement I: Mitochondria and chloroplasts are both double membrane bound organelles. Statement II: Inner…
Cell: The Unit of Life Mitochondria and Plastids Double-Membrane Organelle Grouping
MediumTwo statementsNew idea
Q187
Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme…
Biomolecules Biomolecule Structure Catalytic Cycle of an Enzyme
MediumOtherNew idea
Q188
Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for…
Organisms and Populations Population Interactions Gause's Principle Limiting Condition
MediumTwo statementsNew idea
Q189
Match List I with List II List-I | List-II A. Exophthalmic goiter | I. Excess secretion of cortisol, moon face, hyperglycemia B.…
Chemical Coordination and Integration Endocrine Glands and Hormone Action Endocrine Disorders
EasyMatch the listsIdea asked in 5 papers
Q190
As per ABO blood grouping system, the blood group of father is B $^+$ , mother is A $^+$ and child is O $^+$ . Their respective genotype can be…
Principles of Inheritance and Variation Mendelian Inheritance ABO Blood Group System
MediumOtherIdea asked in 2 papers
Q191
The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous…
Animal Kingdom Chordate Classes Fundamental Chordate Features
EasyOtherIdea asked in 6 papersAsked the year before
Q192
Match List I with List II related to digestive system of cockroach. List-I | List-II A. The structures used for storing of food. | I.…
Structural Organisation in Animals Cockroach Anatomy Digestive Tract Anatomy
MediumMatch the listsIdea asked in 2 papers
Q193
Choose the correct statement given below regarding juxta medullary nephron.
Excretory Products and their Elimination Urine Formation Cortical vs Juxtamedullary Nephrons
MediumOne-line MCQIdea asked in 2 papersAsked the year before
Q194
Match List I with List II List-I | List-II A. P wave | I. Heart muscles are electrically silent. B. QRS complex | II. Depolarisation of…
Body Fluids and Circulation Electrocardiogram P-Wave Interpretation
EasyMatch the listsIdea asked in 2 papers
Q195
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
Human Reproduction Male Reproductive System Hormonal Regulation of Spermatogenesis
MediumFigure-basedNew idea
Q196
Match List I with List II List-I | List-II A. Unicellular glandular epithelium | I. Salivary glands B. Compound epithelium | II. Pancreas…
Structural Organisation in Animals Animal Tissues Unicellular vs. Multicellular Glands
MediumMatch the listsNew idea
Q197
Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II:…
Neural Control and Coordination Neural System and Brain Midbrain, Hindbrain and Brain Stem
EasyTwo statementsNew idea
Q198
Match List I with List II List-I | List-II A. Mesozoic Era | I. Lower invertebrates B. Proterozoic Era | II. Fish & Amphibia C. Cenozoic…
Evolution Origin of Life and Human Evolution Geological Eras and Life Forms
MediumMatch the listsNew idea
Q199
Match List I with List II List-I | List-II A. RNA polymerase III | I. snRNP $_s$ B. Termination of transcription | II. Promotor…
Molecular Basis of Inheritance Transcription Process RNA Polymerase III Function
MediumMatch the listsIdea asked in 3 papersAsked the year before
Q200
Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are…
Human Health and Disease Immunity and Lymphoid Organs Primary and Secondary Lymphoid Organs
MediumTwo statementsNew ideaIdea asked in 3 papers

Questions from the official NEET UG 2024 paper (NTA). Chapter, topic and idea tags and difficulty are Lumi’s.

Biology in every NEET paper

NEET 2024 Physics NEET 2024 Chemistry The whole 2024 paper Biology across ten years