NEET UG · Biology · Molecular Basis of Inheritance
Predicting mRNA from Template Strand
NEET asked Predicting mRNA from Template Strand once in 2017–2026, in 2024. It belongs to Transcription Process, in Molecular Basis of Inheritance (Biology).
Updated 2026-10-08
- Times asked
- 1
- in 2017–2026
- Papers
- 1
- of 10
- First asked
- 2024
- the only time
- Chance next paper
- 6%
- calibrated historical rate
Questions on this idea, by paper
2017–2026. 2024.
How NEET framed it
One-line MCQ is the usual form. Skill tested: application.
- Numerical
Chance asked next paper 6%
Every question
The question
From the official NEET UG papers, newest first. Open one for the full question, the options and the official answer.
- 2024 Q164Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'One-line MCQ · Easy
Papers: NEET 2024.
Same topic
Other ideas in Transcription Process
Transcription Process has 12 ideas NEET has asked; 2 of them came up in more than one question.
- RNA Polymerase III Function3× · 2024
- Initiation/Elong/Term2× · 2021
- RNA Polymerase II Functiononce · 2026
- Post-Transcriptional Modsonce · 2025
- Rho Factor Functiononce · 2025
- Transcription Unit Partsonce · 2024
- Deducing Coding Strand Sequenceonce · 2023
- Local Unwinding by RNA Polymeraseonce · 2020
- Deriving mRNA from Coding Strandonce · 2018
- Relative Abundance of RNA Typesonce · 2017
- Spliceosome Mechanismonce · 2017