NEET UG · Biology · Class 12
Molecular Basis of Inheritance: NEET previous year questions
61 questions in ten years of NEET, asked in 10 of 10 years. Here is what this chapter tests and how.
- Asked in 10 years
- 61
- 10 of 10 papers
- 10-year average
- 5.8
- a paper · 5.1 since 2024 -1.0
- Typical range
- 4–8
- questions a paper; fewest 2, most 8
- Weighted estimate
- 5.8
- model, recent papers count more · about 23 marks
- Typical range (fact)
- 10-year average (fact)
- Weighted estimate (model)
Typical range: questions per paper in the middle eight of the ten papers, leaving out the single highest and lowest year (about the 10th to 90th percentile), each paper scaled to 180 questions. The ten-year average and the range are historical fact. The weighted estimate is a model: each paper's share, with recent papers counting more (half-life three years), and dropped syllabus removed. It is a guide to effort, not a forecast.
What to do
How to spend time on Molecular Basis of Inheritance
Priority
Among the chapters that held the first half of all NEET questions in ten years. How bands are set
- Past questions
- 61in 10 of 10 papers
- Study plan gives it
- 33 hover 12 months; 25 h over 6
Ideas asked most often
- lac z, y and a Gene Products3×
- RNA Polymerase III Function3×
- Inducer and Repressor Control2×
- Euchromatin vs Heterochromatin2×
- Histone Amino Acid Composition2×
360 of the 424 ideas in Lumi’s map of this chapter have not been asked or touched in ten years. New questions often come from ideas like these, so learn the whole chapter, not just the list above.
Questions per year
Kind of question
SHARE OF 10 YEARS- Recall54%
- Concept12%
- Calculation10%
- Application8%
- Match the lists8%
- Two statements8%
Most common asks: definition recall (7); numerical (6); identify scientist for a discovery (3).
Profile
This chapter in numbers
Where it ranks, how steady it is, and what it costs to study.
- Rank, all NEET chapters
- #1
- of 80 by weighted estimate
- Rank in Biology
- #1
- of 32 chapters
- Share of the paper
- 3.2%
- ten-year average
- Busiest year
- 2021
- 9 questions
- Year to year
- Swings a lot
- varies by about 1.8 questions
- Long-run direction
- -0.08
- questions per paper, per year
- Easy questions
- 54%
- 47% of ideas rated hard
- With a figure
- 2%
- graph, diagram or structure
- Botany / Zoology
- 47 / 14
- questions by section
- Study time
- 33 h
- 25 h on a 6-month plan
- Marks per study hour
- 0.70
- #10 of 80 chapters
- Foundation for others
- 56%
- of its ideas are used in other chapters
Difficulty, year by year
Each question rated easy, medium or hard against NCERT.
- 20176
- 20186
- 20195
- 20204
- 20219
- 20227
- 20238
- 20246
- 20258
- 20262
- Easy
- Medium
- Hard
What it asks you to do
SHARE OF QUESTIONS- Recall64%
- Concept18%
- Application10%
- Calculation7%
- Multi-step2%
Coverage
How much of the chapter NEET has used
We split the chapter into 424 ideas. In ten years NEET built a question around 39 of them. Most of the chapter has never been asked, which is why learning it whole beats memorising past questions.
- Asked as the main idea
- 39
- Touched on in a question
- 25
- Never asked
- 360
Topics
What repeats, topic by topic
Questions per topic in each year's paper. Topics that come every year are worth learning first.
- DNA Double Helix · Every year162123233
- Transcription Process · Every year1521132321
- Genetic Code and Translation · Every year1212212112
- Gene Regulation and the lac Operon · Every year7211111
- Human Genome Project · Every year611211
- DNA Replication · Due again51112
| Topic | 2017 | ’18 | 2019 | ’20 | 2021 | ’22 | 2023 | ’24 | 2025 | ’26 | Total |
|---|---|---|---|---|---|---|---|---|---|---|---|
| DNA Double HelixEvery year | 2 | · | 1 | 2 | 3 | 2 | 3 | · | 3 | · | 16 |
| Transcription ProcessEvery year | 2 | 1 | · | 1 | 3 | · | 2 | 3 | 2 | 1 | 15 |
| Genetic Code and TranslationEvery year | 1 | 2 | 2 | 1 | 2 | 1 | 1 | · | 2 | · | 12 |
| Gene Regulation and the lac OperonEvery year | · | 2 | 1 | · | · | 1 | 1 | 1 | · | 1 | 7 |
| Human Genome ProjectEvery year | · | · | 1 | · | 1 | 2 | 1 | · | 1 | · | 6 |
| DNA ReplicationDue again | 1 | 1 | · | · | · | 1 | · | 2 | · | · | 5 |
Drill down
Topic, idea, question
Open a topic to see every idea NEET tested inside it, then open an idea to read the questions. Each row shows its ten papers.
12 ideas inside
- Repeated2 · 13%
- Repeated2 · 13%
- Repeated2 · 13%
- Repeated2 · 13%
- 1 · 6%
- 1 · 6%
- 1 · 6%
- 1 · 6%
- 1 · 6%
- 1 · 6%
- 1 · 6%
- 1 · 6%
Squares are the ten papers, 2017 to 2026; darker means more questions. Share is of the level above.
Ideas
The exact ideas NEET has asked
Inside the topics, 47 different ideas were tested. These came more than once, or are new since 2024.
- lac z, y and a Gene Products3×
match list on lac operon genes
- RNA Polymerase III Function3×
identify role of a polymerase
- Inducer and Repressor Control2×
predict outcome of operon mutation
- Euchromatin vs Heterochromatin2×
count correct statements on chromatin
- Histone Amino Acid Composition2×
identify wrong statement on histones
- Semi-conservative Model2×
organism used in classic experiment
- Hershey-Chase Experiment2×
identify scientist for a discovery
- Ribosome Structure and Role2×
recall number of items
- DNA Length Calculation2×
numerical
- Initiation/Elong/Term2×
true statement selection on transcription
- Properties of Genetic Code2×
statement i/ii on genetic code
- Frameshift Mutations and the Reading Frame2×
predict effect of mutation on reading frame
- RNA Polymerase II FunctionNew1×
identify enzyme function
- RNA World Structural EvidenceNew1×
statement i/ii on genetic material
- Salient Features of HGPNew1×
definition recall
- Post-Transcriptional ModsNew1×
count correct statements on transcription
- Rho Factor FunctionNew1×
identify factor for a step
- George Gamow's Triplet Code PropositionNew1×
identify scientist for a discovery
- tRNA as Adapter MoleculeNew1×
statement i/ii on rna functions
- Polymerase DirectionalityNew1×
true statement selection on dna replication
- Predicting mRNA from Template StrandNew1×
numerical
- Transcription Unit PartsNew1×
identify regions of transcription unit
Every question
Molecular Basis of Inheritance questions, year by year
The opening words of each question as it appeared in the official paper.
NEET 20262 questions
- Q153Which of the following statements about lac-operon is correct ?One-line MCQ
- Q167Which of the following enzymes synthesizes precursor mRNA ?One-line MCQ
NEET 20258 questions
- Q96Given below are two statements : Statement I : In the RNA world, RNA is considered the first genetic material evolved to carry out…Two statements
- Q106Which chromosome in the human genome has the highest number of genes?One-line MCQ
- Q114Given below are two statements : Statement I : Transfer RNAs and ribosomal RNA do not interact with mRNA. Statement II : RNA interference…Two statements
- Q129Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing.…Other
- Q134Match List I with List II : List-I | List-II A. Alfred Hershey and Martha Chase | I. Streptococcus pneumoniae B. Euchromatin | II. Densely…Match the lists
- Q146Histones are enriched with -One-line MCQ
- Q163Who proposed that the genetic code for amino acids should be made up of three nucleotides?One-line MCQ
- Q174Which factor is important for termination of transcription?One-line MCQ
NEET 20246 questions
- Q101The lactose present in the growth medium of bacteria is transported to the cell by the action of:One-line MCQ
- Q124A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;One-line MCQ
- Q147Which of the following statement is correct regarding the process of replication in ?One-line MCQ
- Q148Match List I with List II List I | List II A. Frederick Griffith | I. Genetic code B. Francois Jacob & Jacque Monod | II.…Match the lists
- Q164Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'One-line MCQ
- Q199Match List I with List II List-I | List-II A. RNA polymerase III | I. snRNP B. Termination of transcription | II. Promotor…Match the lists
NEET 20238 questions
- Q104Expressed Sequence Tags (ESTs) refers toOne-line MCQ
- Q113What is the role of RNA polymerase III in the process of transcription in Eukaryotes?One-line MCQ
- Q118Unequivocal proof that DNA is the genetic material was first proposed byOne-line MCQ
- Q146How many different proteins does the ribosome consist of?One-line MCQ
- Q151Match List I with List II. List I | List II A. Gene 'a' | I. β-galactosidase B. Gene 'y' | II. Transacetylase C. Gene 'i' | III. Permease…Match the lists
- Q181Given below are two statements: Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a…Two statements
- Q184Given below are two statements: Statement I: RNA mutates at a faster rate. Statement II: Viruses having RNA genome and shorter life span…Two statements
- Q193Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'…One-line MCQ
NEET 20227 questions
- Q113DNA polymorphism forms the basis of :One-line MCQ
- Q122Read the following statements and choose the set of correct statements : (a) Euchromatin is loosely packed chromatin (b) Heterochromatin…Other
- Q130The process of translation of mRNA to proteins begins as soon as :One-line MCQ
- Q140If a geneticist uses the blind approach for sequencing the whole genome of an organism, followed by assignment of function to different…One-line MCQ
- Q171If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs ?Numerical
- Q177In an E.coli strain i gene gets mutated and its product can not bind the inducer molecule. If growth medium is provided with lactose, what…One-line MCQ
- Q200Ten E.coli cells with - dsDNA are incubated in medium containing nucleotide. After 60 minutes, how…Numerical
NEET 20219 questions
- Q134Complete the flow chart on central dogma. (a) [circular arrow on] DNA mRNA (d)One-line MCQ · figure
- Q138Identify the correct statement.One-line MCQ
- Q144DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as :One-line MCQ
- Q149What is the role of RNA polymerase III in the process of transcription in eukaryotes ?One-line MCQ
- Q157Which of the following RNAs is not required for the synthesis of protein ?One-line MCQ
- Q172If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it ?Numerical
- Q174Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and Termination in the process of transcription in…One-line MCQ
- Q186Statement I : The codon 'AUG' codes for methionine and phenylalanine. Statement II : 'AAA' and 'AAG' both codons code for the amino acid…Two statements
- Q190Which one of the following statements about Histones is wrong ?One-line MCQ
NEET 20204 questions
- Q33The first phase of translation is :One-line MCQ
- Q67Name the enzyme that facilitates opening of DNA helix during transcription.One-line MCQ
- Q74If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical…Numerical
- Q77Which of the following statements is correct ?One-line MCQ
NEET 20195 questions
- Q115Purines found both in DNA and RNA are :One-line MCQ
- Q154Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology ?One-line MCQ
- Q158Expressed Sequence Tags (ESTs) refers to :One-line MCQ
- Q166Match the following genes of the Lac operon with their respective products : (a) i gene | (i) β-galactosidase (b) z gene | (ii) Permease…Match the lists
- Q172Under which of the following conditions will there be no change in the reading frame of following mRNA ? 5′ AACAGCGGUGCUAUU 3′One-line MCQ
NEET 20186 questions
- Q102Select the correct match :One-line MCQ
- Q106The experimental proof for semiconservative replication of DNA was first shown in aOne-line MCQ
- Q109Select the correct match :One-line MCQ
- Q158All of the following are part of an operon exceptOne-line MCQ
- Q161AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?One-line MCQ
- Q174Many ribosomes may associate with a single mRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are…One-line MCQ
NEET 20176 questions
- Q100The final proof for DNA as the genetic material came from the experiments of :One-line MCQ
- Q104During DNA replication, Okazaki fragments are used to elongate :One-line MCQ
- Q111Spliceosomes are not found in cells of :One-line MCQ
- Q124The association of histone H1 with a nucleosome indicates :One-line MCQ
- Q130If there are 999 bases in an RNA that codes for a protein with 333 amino acids, and the base at position 901 is deleted such that the…Numerical
- Q140Which of the following RNAs should be most abundant in animal cell ?One-line MCQ
Questions from the official NEET UG papers published by NTA (CBSE before 2019). Topic and idea tags, counts and notes are Lumi’s.