NEET UG 2024 · Code T2

NEET 2024 paper, question by question

All 200 questions from the NEET UG 2024 paper, tagged to chapter, topic and idea. How hard it was, what it asked, what was new and what came back.

← NEET 2023 NEET 2025 →

Questions: 200; 200 printed, 180 answered
Chapters asked: 76; 2 usual chapters skipped
Easy / hard: 54% / 3%; share of the paper
Need a calculation: 19%; Physics alone: 44%
New ideas: 59%; of questions tested an idea not asked before
Use a figure: 16%; 17 in Physics, 8 in Chemistry
From Class 12: 52%; of the questions, all subjects
Same idea as last year: 9.0%; 18 questions

Key findings · NEET 2024

1
54% of questions were easy, in line with the ten-year average of 54%.
2
About 37 questions (19%) needed a calculation, against 21% on average; Physics alone was 44% calculation.
3
Biodiversity and Conservation got the biggest boost: 5 questions against a usual 2.1, followed by Biomolecules (6 vs 3.1).
4
Physics tilted to Class 12: 30 of 50 questions, against a usual 56%.
5
59% of tagged questions tested an idea no earlier paper had asked, the lowest of the 9 papers measured, yet 98% came from a topic seen before.

Subjects

How the 2024 paper split

Questions per subject, the Class 11 and Class 12 balance, and how hard each part was.

Physics

25% of the paper

50questions · 24 chapters

Class 11 and 12

2030

Class 11
Class 12

Difficulty

2721

Easy
Medium
Hard

New ideas: 30 (60%)
Use a figure: 17
Calculation: 44%
Figure-based: 24%
Concept: 18%

Chemistry

25% of the paper

50questions · 20 chapters

Class 11 and 12

2426

Class 11
Class 12

Difficulty

2621

Easy
Medium
Hard

New ideas: 31 (62%)
Use a figure: 8
Calculation: 26%
Application: 22%
Recall: 18%

Biology

50% of the paper

100questions · 32 chapters

Botany and Zoology

5050

Botany
Zoology

Class 11 and 12

5248

Class 11
Class 12

Difficulty

5545

Easy
Medium
Hard

New ideas: 57 (57%)
Use a figure: 7
Match the lists: 30%
Recall: 30%
Concept: 16%

Compared

Versus 2023 and the ten-year average

Each measure for this paper, next to the year before and the average of all ten papers. Changes are in percentage points.

Questions in the paper200
2023: 199 +1Avg: 188 +13
Chapters asked76
2023: 89 -13Avg: 84 -8
Easy questions54.0%
2023: 54.3% -0.3Avg: 54.0% 0.0
Hard questions2.5%
2023: 2.0% +0.5Avg: 2.7% -0.2
Need a calculation18.5%
2023: 18.1% +0.4Avg: 21.2% -2.7
Straight recall41.0%
2023: 48.7% -7.7Avg: 46.3% -5.3
Use a figure16.0%
2023: 11.1% +4.9Avg: 10.5% +5.5
Statements, assertion–reason, match29.0%
2023: 23.6% +5.4Avg: 14.5% +14.5
Test a new idea59.0%
2023: 64.3% -5.3Avg: 73.9% -14.9
Same idea as the year before9.0%
2023: 7.5% +1.5Avg: 6.8% +2.2
From Class 1252.0%
2023: 51.8% 0.2Avg: 51.9% 0.1
Physics: easy54.0%
2023: 65.3% -11.3Avg: 47.0% +7.0
Chemistry: easy52.0%
2023: 38.0% +14.0Avg: 46.6% +5.4
Biology: easy55.0%
2023: 57.0% -2.0Avg: 61.0% -6.0

Measure	2024	2023	Change	Ten-year avg	Vs avg
Questions in the paper	200	199	+1	188	+13
Chapters asked	76	89	-13	84	-8
Easy questions	54.0%	54.3%	-0.3	54.0%	0.0
Hard questions	2.5%	2.0%	+0.5	2.7%	-0.2
Need a calculation	18.5%	18.1%	+0.4	21.2%	-2.7
Straight recall	41.0%	48.7%	-7.7	46.3%	-5.3
Use a figure	16.0%	11.1%	+4.9	10.5%	+5.5
Statements, assertion–reason, match	29.0%	23.6%	+5.4	14.5%	+14.5
Test a new idea	59.0%	64.3%	-5.3	73.9%	-14.9
Same idea as the year before	9.0%	7.5%	+1.5	6.8%	+2.2
From Class 12	52.0%	51.8%	0.2	51.9%	0.1
Physics: easy	54.0%	65.3%	-11.3	47.0%	+7.0
Chemistry: easy	52.0%	38.0%	+14.0	46.6%	+5.4
Biology: easy	55.0%	57.0%	-2.0	61.0%	-6.0

Repetition

What came back, and what was new

Almost every question sits in a chapter NEET has asked before, and most in a known topic. The exact idea is a different story: most are new.

Questions whose … had appeared before

ANY PAPER 2017–2023

Chapter100%
Topic98%
Exact idea41%
Exact idea, in 20239%

Topic and idea shares count only the questions we could tag to a topic. The ten-paper window grows each year, so early years look newer than they are.

Questions testing a new idea, by year

Share of each paper whose idea had never been asked in an earlier paper.

–’17 95%’18 89%’19 84%’20 86%’21 66%’22 64%’23 59%’24 62%’25 59%’26

Same idea as the year before

Share of each paper that repeated an idea from the previous paper.

–’17 5.0%’18 5.0%’19 6.1%’20 3.5%’21 7.0%’22 7.5%’23 9.0%’24 10.6%’25 7.8%’26

Chapters

Which chapters got more, and which got less

Questions a chapter had in 2024 minus its usual: its ten-year average per 180 questions. Counts are scaled to 180 questions so years compare fairly.

More than usual

Biodiversity and Conservation · Biology+2.45 questions · usually 2.1
Biomolecules · Biology+2.36 questions · usually 3.1
Human Health and Disease · Biology+2.26 questions · usually 3.2
Equilibrium · Chemistry+2.05 questions · usually 2.5
Magnetism and Matter · Physics+1.93 questions · usually 0.8
Electrostatic Potential and Capacitance · Physics+1.44 questions · usually 2.2
Some Basic Concepts of Chemistry · Chemistry+1.43 questions · usually 1.3
Chemical Bonding and Molecular Structure · Chemistry+1.34 questions · usually 2.3
Principles of Inheritance and Variation · Biology+1.36 questions · usually 4.1
Haloalkanes and Haloarenes · Chemistry+1.23 questions · usually 1.5

Less than usual, or skipped

Plant Kingdom · Biology−2.11 question · usually 3.0
Hydrocarbons · Chemistry−1.51 question · usually 2.4
Electric Charges and Fields · Physics−1.4Not asked · usually 1.4
The p-Block Elements (Class 11) · Chemistry−1.3Not asked · usually 1.3
Moving Charges and Magnetism · Physics−1.21 question · usually 2.1
Organisms and Populations · Biology−1.22 questions · usually 3.0
Ecosystem · Biology−1.01 question · usually 1.9
Locomotion and Movement · Biology−0.91 question · usually 1.8
Sexual Reproduction in Flowering Plants · Biology−0.93 questions · usually 3.6
Biological Classification · Biology−0.82 questions · usually 2.5

All 76 chapters asked

Physics · 24

Chemistry · 20

Biology · 32

Topics

Busiest topics in 2024

Biomolecule StructureBiomolecules · 33 in ten years6
Mendelian InheritancePrinciples of Inheritance and Variation · 20 in ten years5
Ohm's Law and ResistanceCurrent Electricity · 28 in ten years4
Aldehydes, Ketones and Carboxylic AcidsAldehydes, Ketones and Carboxylic Acids · 22 in ten years4
Flower StructureMorphology of Flowering Plants · 19 in ten years4
Cloning VectorsBiotechnology: Principles and Processes · 18 in ten years4
Magnetism and MatterMagnetism and Matter · 8 in ten years3
Units and DimensionsUnits and Measurements · 20 in ten years3
Chemical KineticsChemical Kinetics · 21 in ten years3
Nucleophilic SubstitutionHaloalkanes and Haloarenes · 16 in ten years3
Chemical EquilibriumEquilibrium · 11 in ten years3
Mole ConceptSome Basic Concepts of Chemistry · 14 in ten years3

Question format

SHARE OF 2024

One-line MCQ · 68 Q34%
Match the lists · 39 Q20%
Numerical · 32 Q16%
Other · 22 Q11%
Figure-based · 20 Q10%
Two statements · 16 Q8%
Assertion–reason · 3 Q2%

What the question tests

SHARE OF 2024

Recall · 82 Q41%
Concept · 44 Q22%
Calculation · 28 Q14%
Application · 20 Q10%
Multi-step · 14 Q7%
Figure reading · 7 Q4%
Data or graph · 5 Q3%

Drill down

What 2024 asked, and its history

Every chapter the 2024 paper asked, with all its topics and ideas. Counts and squares cover all ten papers; rows 2024 did not ask are faded, and questions from other years link to their own paper.

subjectAskedShareYears’17’18’19’20’21’22’23’24’25’26

Open100 this paper940 · 50%50%10/10909090901001001001009090
Open50 this paper469 · 25%25%10/1045454545504950504545
Open50 this paper466 · 25%25%10/1043454545505049504544

Squares are the ten papers, 2017 to 2026; darker means more questions. Share is of the level above.

Every question

All 200 questions of NEET 2024

The opening words of each question as printed, with its chapter, topic and how hard it was. “New idea” means no earlier paper had tested it.

Subject

Difficulty

Idea

Find

200 of 200 questions

Physics50 questions

27 easy21 medium2 hard

Q1
A wheel of a bullock cart is rolling on a level road as shown in the figure below. If its linear speed is $v$ in the direction shown,…
System of Particles and Rotational Motion Rotational MotionVelocities of Points on a Rolling Wheel
EasyOne-line MCQ · figureNew idea
Q2
An unpolarised light beam strikes a glass surface at Brewster's angle. Then
Wave Optics Single Slit DiffractionPolarisation and Malus's Law
EasyOne-line MCQIdea asked in 5 papers
Q3
In a uniform magnetic field of 0.049 T, a magnetic needle performs 20 complete oscillations in 5 seconds as shown. The moment of inertia…
Magnetism and MatterMagnet Oscillating in a Field
MediumNumerical · figureNew idea
Q4
Consider the following statements A and B and identify the correct answer : [graph: I vs V axes with quadrants (I)-(IV)] A. For a…
Semiconductor Electronics: Materials, Devices and Simple Circuits Semiconductor DevicesPhotodiodes, LEDs and Solar Cells
MediumFigure-basedIdea asked in 2 papersAsked the year before
Q5
Match List I with List II. List I (Spectral Lines of Hydrogen for transitions from) | List II (Wavelengths (nm)) A. $n_2 = 3$ to $n_1 = 2$ …
Atoms Bohr's Atomic ModelBalmer Series Visible Spectrum
MediumMatch the listsNew idea
Q6
A thin spherical shell is charged by some source. The potential difference between the two points $C$ and $P$ (in V) shown in the figure…
Electrostatic Potential and Capacitance Electrostatic PotentialPotential and Energy near a Charged Sphere
EasyFigure-basedNew ideaIdea asked in 2 papers
Q7
A thermodynamic system is taken through the cycle $abcda$ . The work done by the gas along the path $bc$ is :
Thermodynamics Laws of ThermodynamicsWork and First Law from P-V Graphs
EasyFigure-basedNew idea
Q8
Two bodies A and B of same mass undergo completely inelastic one dimensional collision. The body A moves with velocity $v_1$ while body B…
Work, Energy and Power Power and CollisionsInelastic Collisions
EasyNumericalNew idea
Q9
A horizontal force 10 N is applied to a block $A$ as shown in figure. The mass of blocks $A$ and $B$ are 2 kg and 3 kg, respectively. The…
Laws of Motion Newton's Laws of MotionContact Force Between Adjacent Blocks
EasyFigure-basedNew idea
Q10
If $c$ is the velocity of light in free space, the correct statements about photon among the following are : A. The energy of a photon is…
Dual Nature of Radiation and Matter Photoelectric EffectPhoton Momentum and Effective Mass
EasyOtherNew ideaIdea asked in 3 papers
Q11
At any instant of time $t$ , the displacement of any particle is given by $2t - 1$ (SI unit) under the influence of force of 5N. The value…
Work, Energy and Power Work-Energy TheoremInstantaneous Power
MediumNumericalNew idea
Q12
If the monochromatic source in Young's double slit experiment is replaced by white light, then
Wave Optics Young's Double SlitYDSE with White Light
EasyOne-line MCQNew idea
Q13
In the following circuit, the equivalent capacitance between terminal $A$ and terminal $B$ is :
Electrostatic Potential and Capacitance CapacitanceWheatstone Bridge of Capacitors
EasyFigure-basedNew idea
Q14
A light ray enters through a right angled prism at point $P$ with the angle of incidence 30° as shown in figure. It travels through the…
Ray Optics and Optical Instruments Snell's LawGrazing Emergence Condition
HardFigure-basedNew idea
Q15
The output ( $Y$ ) of the given logic gate is similar to the output of an/a :
Semiconductor Electronics: Materials, Devices and Simple Circuits Logic GatesNAND to NOT Conversion
MediumFigure-basedNew idea
Q16
A particle moving with uniform speed in a circular path maintains :
Laws of Motion Uniform Circular MotionCentripetal Acceleration
EasyOne-line MCQNew idea
Q17
The quantities which have the same dimensions as those of solid angle are :
Units and Measurements Units and DimensionsDimensionless Physical Quantities
EasyOne-line MCQIdea asked in 2 papers
Q18
In a vernier calipers, $(N + 1)$ divisions of vernier scale coincide with $N$ divisions of main scale. If 1 MSD represents 0.1 mm, the…
Units and Measurements Units and DimensionsVernier Caliper Least Count
MediumNumericalNew idea
Q19
The terminal voltage of the battery, whose emf is 10 V and internal resistance 1 Ω, when connected through an external resistance of 4 Ω…
Current Electricity Ohm's Law and ResistanceCell Internal Resistance
EasyNumerical · figureNew idea
Q20
A bob is whirled in a horizontal plane by means of a string with an initial speed of $\omega$ rpm. The tension in the string is $T$ . If…
Laws of Motion Uniform Circular MotionTension in a Rotating Horizontal String
EasyNumericalNew idea
Q21
If $x = 5\sin\left(\pi t + \frac{\pi}{3}\right)$ m represents the motion of a particle executing simple harmonic motion, the amplitude and…
Oscillations Simple Harmonic MotionSHM Displacement Equation
EasyNumericalNew idea
Q22
In an ideal transformer, the turns ratio is $\frac{N_p}{N_s} = \frac{1}{2}$ . The ratio $V_s : V_p$ is equal to (the symbols carry their…
Alternating Current LCR CircuitsIdeal Transformer
EasyNumericalIdea asked in 3 papersAsked the year before
Q23
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R. Assertion A : The potential ( $V$ ) at…
Electrostatic Potential and Capacitance Electrostatic PotentialPotential of an Electric Dipole
MediumAssertion–reasonIdea asked in 2 papers
Q24
A thin flat circular disc of radius 4.5 cm is placed gently over the surface of water. If surface tension of water is 0.07 N m $^{-1}$ ,…
Mechanical Properties of Fluids Surface TensionLifting Force for a Disc
EasyNumericalNew idea
Q25
A tightly wound 100 turns coil of radius 10 cm carries a current of 7 A. The magnitude of the magnetic field at the centre of the coil is…
Moving Charges and Magnetism Biot-Savart LawField at Center of Loop
EasyNumericalNew idea
Q26
Given below are two statements : Statement I : Atoms are electrically neutral as they contain equal number of positive and negative…
Atoms Bohr's Atomic ModelAtomic Neutrality and Emission Spectra
EasyTwo statementsNew idea
Q27
The moment of inertia of a thin rod about an axis passing through its mid point and perpendicular to the rod is 2400 g cm $^2$ . The length…
System of Particles and Rotational Motion Rotational MotionMoment of Inertia of Standard Bodies
EasyNumericalIdea asked in 3 papers
Q28
[figure: Solenoid-1 (A, B), bar magnet N-S moving with velocity v, Solenoid-2 (C, D)] In the above diagram, a strong bar magnet is moving…
Electromagnetic Induction Lenz's LawMagnet and Loop Relative Motion
MediumFigure-basedNew idea
Q29
$^{290}_{82}X \xrightarrow{\alpha} Y \xrightarrow{e^+} Z \xrightarrow{\beta^-} P \xrightarrow{e^-} Q$ In the nuclear emission stated…
Nuclei Radioactive DecayBalancing Nuclear Decay Equations
MediumNumericalNew idea
Q30
The mass of a planet is $\frac{1}{10}$ th that of the earth and its diameter is half that of the earth. The acceleration due to gravity on…
GravitationAcceleration due to Gravity on a Planet
EasyNumericalIdea asked in 2 papers
Q31
The maximum elongation of a steel wire of 1 m length if the elastic limit of steel and its Young's modulus, respectively, are…
Mechanical Properties of Solids ElasticityHooke's Law and Elastic Limit
MediumNumericalNew idea
Q32
Match List-I with List-II. List-I (Material) | List-II (Susceptibility ( $\chi$ )) A. Diamagnetic | I. $\chi = 0$ B. Ferromagnetic | II.…
Magnetism and MatterDia-, Para- and Ferromagnetism
MediumMatch the listsIdea asked in 2 papers
Q33
A logic circuit provides the output $Y$ as per the following truth table A | B | Y 0 | 0 | 1 0 | 1 | 0 1 | 0 | 1 1 | 1 | 0 The expression…
Semiconductor Electronics: Materials, Devices and Simple Circuits Logic GatesBoolean Algebra Expressions
EasyOne-line MCQ · figureNew idea
Q34
The graph which shows the variation of $\left(\frac{1}{\lambda^2}\right)$ and its kinetic energy, $E$ is (where $\lambda$ is de Broglie…
Dual Nature of Radiation and Matter Photoelectric Effectde Broglie Wavelength of Particles
MediumFigure-basedIdea asked in 4 papers
Q35
A wire of length ' $l$ ' and resistance 100 Ω is divided into 10 equal parts. The first 5 parts are connected in series while the next 5…
Current Electricity Ohm's Law and ResistanceSeries Resistors and Voltage Divider
MediumNumericalIdea asked in 3 papersAsked the year before
Q36
If the mass of the bob in a simple pendulum is increased to thrice its original mass and its length is made half its original length, then…
Oscillations Simple Harmonic MotionSimple Pendulum Time Period
EasyNumericalNew idea
Q37
A force defined by $F = \alpha t^2 + \beta t$ acts on a particle at a given time $t$ . The factor which is dimensionless, if $\alpha$ and…
Units and Measurements Units and DimensionsPrinciple of Homogeneity
MediumOne-line MCQNew idea
Q38
An iron bar of length L has magnetic moment M. It is bent at the middle of its length such that the two arms make an angle 60° with each…
Magnetism and MatterMagnetic Moment of Bar and Bent Magnets
MediumNumericalNew idea
Q39
If the plates of a parallel plate capacitor connected to a battery are moved close to each other, then A. the charge stored in it,…
Electrostatic Potential and Capacitance CapacitanceParallel Plate Capacitor Formula
MediumOtherIdea asked in 2 papers
Q40
A small telescope has an objective of focal length 140 cm and an eye piece of focal length 5.0 cm. The magnifying power of telescope for…
Ray Optics and Optical Instruments Prisms, Dispersion and Optical InstrumentsAstronomical Telescope
EasyNumericalIdea asked in 3 papers
Q41
Two heaters A and B have power rating of 1 kW and 2 kW, respectively. Those two are first connected in series and then in parallel to a…
Current Electricity Ohm's Law and ResistanceJoule Heating and Electrical Power
MediumNumericalIdea asked in 2 papers
Q42
A metallic bar of Young's modulus, $0.5\times10^{11}$ N m $^{-2}$ and coefficient of linear thermal expansion $10^{-5}$ °C $^{-1}$ , length 1…
Thermal Properties of Matter Heat Transfer and Thermal ExpansionLinear Thermal Expansion
EasyNumericalIdea asked in 2 papers
Q43
A parallel plate capacitor is charged by connecting it to a battery through a resistor. If I is the current in the circuit, then in the…
Electromagnetic WavesDisplacement Current
EasyOne-line MCQIdea asked in 5 papersAsked the year before
Q44
Choose the correct circuit which can achieve the bridge balance.
Current Electricity Ohm's Law and ResistanceBalanced Wheatstone Bridge
MediumFigure-basedNew idea
Q45
The minimum energy required to launch a satellite of mass $m$ from the surface of earth of mass $M$ and radius $R$ in a circular orbit at…
GravitationOrbital Speed and Energy of Satellites
HardNumericalIdea asked in 2 papersAsked the year before
Q46
The property which is not of an electromagnetic wave travelling in free space is that :
Electromagnetic WavesEnergy Density of EM Waves
EasyOne-line MCQIdea asked in 2 papers
Q47
The following graph represents the T-V curves of an ideal gas (where T is the temperature and V the volume) at three pressures $P_1$ ,…
Kinetic Theory Kinetic Theory of GasesIdeal Gas Equation
MediumFigure-basedIdea asked in 5 papers
Q48
A sheet is placed on a horizontal surface in front of a strong magnetic pole. A force is needed to : A. hold the sheet there if it is…
Electromagnetic Induction Lenz's LawEddy Current Damping Direction
MediumOtherNew idea
Q49
The velocity ( $v$ ) - time ( $t$ ) plot of the motion of a body is shown below : The acceleration ( $a$ ) - time ( $t$ ) graph that best suits…
Motion in a Straight Line Kinematics in 1DKinematic Graphs
EasyFigure-basedIdea asked in 2 papers
Q50
A 10 $\mu$ F capacitor is connected to a 210 V, 50 Hz source as shown in figure. The peak current in the circuit is nearly ( $\pi = 3.14$ ):
Alternating Current LCR CircuitsCapacitive Reactance Calculation
MediumNumerical · figureIdea asked in 2 papers

Chemistry50 questions

26 easy21 medium3 hard

Q51
A compound with a molecular formula of C $_6$ H $_{14}$ has two tertiary carbons. Its IUPAC name is:
Organic Chemistry - Some Basic Principles and Techniques Organic NomenclatureAlphabetical Branch Naming
MediumOne-line MCQIdea asked in 2 papers
Q52
Given below are two statements : Statement I : Both $[\mathrm{Co(NH_3)_6}]^{3+}$ and $[\mathrm{CoF_6}]^{3-}$ complexes are octahedral but…
Coordination CompoundsVBT: Magnetic Properties
MediumTwo statementsNew idea
Q53
Match List I with List II. List I (Process) | List II (Conditions) A. Isothermal process | I. No heat exchange B. Isochoric process | II.…
Thermodynamics First Law of ThermodynamicsThermodynamic Process Types
EasyMatch the listsNew idea
Q54
Match List I with List II. List I (Molecule) | List II (Number and types of bond/s between two carbon atoms) A. ethane | I. one…
Chemical Bonding and Molecular Structure HybridizationCounting Sigma and Pi Bonds
EasyMatch the listsNew idea
Q55
Which plot of ln k vs $\frac{1}{T}$ is consistent with Arrhenius equation?
Chemical KineticsArrhenius Plot Interpretation
EasyFigure-basedIdea asked in 3 papers
Q56
Match List I with List II. List I (Quantum Number) | List II (Information provided) A. $m_l$ | I. shape of orbital B. $m_s$ | II. size of…
Structure of Atom Quantum NumbersAzimuthal Quantum Number (l)
EasyMatch the listsNew idea
Q57
The energy of an electron in the ground state (n = 1) for He $^+$ ion is $-x$ J, then that for an electron in n = 2 state for Be $^{3+}$ ion…
Structure of Atom Quantum NumbersSingle-Electron Species Energy Exception
MediumNumericalNew ideaIdea asked in 2 papers
Q58
The compound that will undergo S $_N$ 1 reaction with the fastest rate is
Haloalkanes and Haloarenes Nucleophilic SubstitutionAllylic and Benzylic Reactivity
MediumOne-line MCQ · figureIdea asked in 2 papersAsked the year before
Q59
Match List I with List II. List I (Reaction) | List II (Reagents/Condition) A. [cyclohexylidenecyclohexane] $\to$ 2 [cyclohexanone] | I.…
Aldehydes, Ketones and Carboxylic AcidsPreparation of Aldehydes, Ketones and Acids
MediumMatch the lists · figureNew idea
Q60
Match List I with List II. List I (Compound) | List II (Shape/geometry) A. NH $_3$ | I. Trigonal Pyramidal B. BrF $_5$ | II. Square Planar…
Chemical Bonding and Molecular Structure VSEPR TheoryMolecular Shape Prediction
EasyMatch the listsIdea asked in 3 papers
Q61
In which of the following processes entropy increases? A. A liquid evaporates to vapour. B. Temperature of a crystalline solid lowered…
Thermodynamics Gibbs Free EnergyEntropy Change Prediction
EasyOtherIdea asked in 3 papers
Q62
Fehling's solution 'A' is
Aldehydes, Ketones and Carboxylic AcidsTollens' and Fehling's Tests
EasyOne-line MCQIdea asked in 2 papersAsked the year before
Q63
Which one of the following alcohols reacts instantaneously with Lucas reagent?
Alcohols, Phenols and Ethers Alcohols and PhenolsLucas Test
EasyOne-line MCQIdea asked in 2 papers
Q64
For the reaction 2A $\rightleftharpoons$ B + C, K $_c$ = $4\times10^{-3}$ . At a given time, the composition of reaction mixture is : [A] =…
Equilibrium Chemical EquilibriumReaction Quotient and Direction
EasyNumericalNew idea
Q65
1 gram of sodium hydroxide was treated with 25 mL of 0.75 M HCl solution, the mass of sodium hydroxide left unreacted is equal to
Some Basic Concepts of Chemistry Mole ConceptStoichiometric Calculations
EasyNumericalIdea asked in 5 papers
Q66
Intramolecular hydrogen bonding is present in
Chemical Bonding and Molecular Structure Hydrogen BondingIntramolecular Hydrogen Bonding
EasyOne-line MCQ · figureNew idea
Q67
'Spin only' magnetic moment is same for which of the following ions? A. Ti $^{3+}$ B. Cr $^{2+}$ C. Mn $^{2+}$ D. Fe $^{2+}$ E. Sc $^{3+}$ …
The d- and f-Block Elements d- and f-Block ElementsMagnetic Moment and Colour of d- and f-Block Ions
MediumOtherIdea asked in 5 papers
Q68
The reagents with which glucose does not react to give the corresponding tests/products are A. Tollen's reagent B. Schiff's reagent C. HCN…
Biomolecules Biomolecules (Chemistry)Reactions of Open-Chain Glucose
MediumOtherNew idea
Q69
Identify the correct reagents that would bring about the following transformation. [C $_6$ H $_{11}$ ]-CH $_2$ -CH=CH $_2$ $\to$ …
Aldehydes, Ketones and Carboxylic AcidsPreparation of Aldehydes, Ketones and Acids
MediumOne-line MCQ · figureNew idea
Q70
Activation energy of any chemical reaction can be calculated if one knows the value of
Chemical KineticsArrhenius Equation at Two Temperatures
EasyOne-line MCQNew idea
Q71
Arrange the following elements in increasing order of first ionization enthalpy: Li, Be, B, C, N Choose the correct answer from the…
Classification of Elements and Periodicity in Properties Periodic PropertiesIonization Enthalpy Trends
MediumOne-line MCQIdea asked in 3 papers
Q72
Among Group 16 elements, which one does NOT show $-2$ oxidation state?
The p-Block Elements (Class 12)p-Block Elements (Groups 15-18)Trends in Groups 15 to 18
EasyOne-line MCQIdea asked in 3 papers
Q73
Which reaction is NOT a redox reaction?
Redox ReactionsIdentifying Redox Reactions
EasyOne-line MCQNew idea
Q74
In which of the following equilibria, K $_p$ and K $_c$ are NOT equal?
Equilibrium Chemical EquilibriumRelationship Between Kp and Kc
EasyOne-line MCQNew idea
Q75
The Henry's law constant (K $_H$ ) values of three gases (A, B, C) in water are 145, $2\times10^{-5}$ and 35 kbar, respectively. The…
Solutions Solutions and Colligative PropertiesHenry's Law
EasyOne-line MCQNew idea
Q76
Given below are two statements: Statement I : The boiling point of three isomeric pentanes follows the order n-pentane > isopentane >…
Hydrocarbons Hydrocarbons (Alkanes)Boiling Point Trends
EasyTwo statementsNew idea
Q77
Given below are two statements: Statement I : Aniline does not undergo Friedel-Crafts alkylation reaction. Statement II : Aniline cannot…
Amines Amines and Diazonium SaltsFriedel-Crafts Anomaly in Aniline
EasyTwo statementsNew idea
Q78
The highest number of helium atoms is in
Some Basic Concepts of Chemistry Mole ConceptMole-Mass-Particle Conversions
EasyOne-line MCQIdea asked in 3 papers
Q79
Arrange the following elements in increasing order of electronegativity: N, O, F, C, Si Choose the correct answer from the options given…
Classification of Elements and Periodicity in Properties Periodic PropertiesElectronegativity Trends
EasyOne-line MCQNew idea
Q80
The most stable carbocation among the following is:
Organic Chemistry - Some Basic Principles and Techniques Electronic EffectsIntermediate Stability
MediumOne-line MCQ · figureNew idea
Q81
Given below are two statements: Statement I : The boiling point of hydrides of Group 16 elements follow the order H $_2$ O > H $_2$ Te >…
The p-Block Elements (Class 12)p-Block Elements (Groups 15-18)Group 16 Hydrides
EasyTwo statementsIdea asked in 3 papers
Q82
Match List I with List II. List I (Complex) | List II (Type of isomerism) A. $[\mathrm{Co(NH_3)_5(NO_2)}]\mathrm{Cl_2}$ | I. Solvate…
Coordination Compounds Coordination IsomerismStructural Isomerism Identification
EasyMatch the listsNew idea
Q83
On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the…
Organic Chemistry - Some Basic Principles and Techniques Purification, Analysis and Isomerism of Organic CompoundsPurification Techniques
EasyOne-line MCQNew idea
Q84
The E° value for the Mn $^{3+}$ /Mn $^{2+}$ couple is more positive than that of Cr $^{3+}$ /Cr $^{2+}$ or Fe $^{3+}$ /Fe $^{2+}$ due to change of
The d- and f-Block Elements d- and f-Block ElementsTrends in M3+/M2+ Electrode Potentials
HardOne-line MCQNew idea
Q85
Match List I with List II. List I (Conversion) | List II (Number of Faraday required) A. 1 mol of H $_2$ O to O $_2$ | I. 3F B. 1 mol of…
Electrochemistry Nernst EquationDetermining Electron Transfer Number (n)
MediumMatch the listsNew idea
Q86
The products A and B obtained in the following reactions, respectively, are 3ROH + PCl $_3$ $\to$ 3RCl + A ROH + PCl $_5$ $\to$ RCl + HCl + B
Haloalkanes and Haloarenes Nucleophilic SubstitutionAlcohols to Haloalkanes
MediumOne-line MCQNew idea
Q87
Identify the correct answer.
Chemical Bonding and Molecular Structure VSEPR TheoryResonance Hybrid Geometries
MediumOne-line MCQNew idea
Q88
The rate of a reaction quadruples when temperature changes from 27°C to 57°C. Calculate the energy of activation. Given R = 8.314 J…
Chemical KineticsArrhenius Equation at Two Temperatures
MediumNumericalNew idea
Q89
Given below are certain cations. Using inorganic qualitative analysis, arrange them in increasing group number from 0 to VI. A. Al $^{3+}$ …
Equilibrium Qualitative Inorganic AnalysisGroup Separation of Cations
MediumOtherNew ideaIdea asked in 2 papers
Q90
The plot of osmotic pressure ( $\Pi$ ) vs concentration (mol L $^{-1}$ ) for a solution gives a straight line with slope 25.73 L bar…
Solutions Solutions and Colligative PropertiesOsmotic Pressure
MediumNumericalIdea asked in 2 papers
Q91
The work done during reversible isothermal expansion of one mole of hydrogen gas at 25°C from pressure of 20 atmosphere to 10 atmosphere…
Thermodynamics First Law of ThermodynamicsReversible Isothermal Work
MediumNumericalNew idea
Q92
A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is : (Given atomic masses of A =…
Some Basic Concepts of Chemistry Mole ConceptEmpirical and Molecular Formula
MediumNumericalIdea asked in 2 papers
Q93
During the preparation of Mohr's salt solution (Ferrous ammonium sulphate), which of the following acid is added to prevent hydrolysis of…
Equilibrium pH and Buffer SolutionspH of Salt Solutions
EasyOne-line MCQNew idea
Q94
The pair of lanthanoid ions which are diamagnetic is
The d- and f-Block Elements d- and f-Block ElementsMagnetic Moment and Colour of d- and f-Block Ions
HardOne-line MCQIdea asked in 5 papers
Q95
Consider the following reaction in a sealed vessel at equilibrium with concentrations of N $_2$ = $3.0\times10^{-3}$ M, O $_2$ =…
Equilibrium Chemical EquilibriumDegree of Dissociation and Equilibrium Constant
HardNumericalNew idea
Q96
Given below are two statements : Statement I : $[\mathrm{Co(NH_3)_6}]^{3+}$ is a homoleptic complex whereas $[\mathrm{Co(NH_3)_4Cl_2}]^+$ …
Coordination CompoundsHomoleptic vs Heteroleptic Complexes
EasyTwo statementsIdea asked in 2 papersAsked the year before
Q97
For the given reaction: [C $_6$ H $_{11}$ ]-CH=CH-[C $_6$ H $_{11}$ ] $\xrightarrow{\mathrm{KMnO_4/H^+}}$ 'P' (major product) 'P' is
Aldehydes, Ketones and Carboxylic AcidsPreparation of Aldehydes, Ketones and Acids
EasyOne-line MCQ · figureNew idea
Q98
Major products A and B formed in the following reaction sequence, are [2-methylcyclohexan-1-ol] $\xrightarrow{\mathrm{PBr_3}}$ A (major)…
Haloalkanes and Haloarenes Nucleophilic SubstitutionAqueous vs Alcoholic KOH
MediumOne-line MCQ · figureNew idea
Q99
Identify the major product C formed in the following reaction sequence : CH $_3$ -CH $_2$ -CH $_2$ -I $\xrightarrow{\mathrm{NaCN}}$ A…
Amines Amines and Diazonium SaltsGabriel and Hoffmann Synthesis
MediumOne-line MCQIdea asked in 2 papers
Q100
Mass in grams of copper deposited by passing 9.6487 A current through a voltmeter containing copper sulphate solution for 100 seconds is:…
Electrochemistry Electrolytic Conductance and ElectrolysisFaraday's Laws of Electrolysis
MediumNumericalIdea asked in 2 papers

Botany50 questions

28 easy22 medium0 hard

Q101
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
Molecular Basis of Inheritance Gene Regulation and the lac Operonlac z, y and a Gene Products
MediumOne-line MCQIdea asked in 3 papersAsked the year before
Q102
Identify the type of flowers based on the position of calyx, corolla and androecium with respect to the ovary from the given figures (a)…
Morphology of Flowering Plants Flower StructureOvary Position and Whorls
MediumFigure-basedNew idea
Q103
The type of conservation in which the threatened species are taken out from their natural habitat and placed in special setting where they…
Biodiversity and Conservation Conservation StrategiesEx-situ Conservation Definition
EasyOne-line MCQNew idea
Q104
Formation of interfascicular cambium from fully developed parenchyma cells is an example for
Plant Growth and Development Plant Growth and DifferentiationDedifferentiation and Redifferentiation
EasyOne-line MCQIdea asked in 3 papersAsked the year before
Q105
Which of the following is an example of actinomorphic flower?
Morphology of Flowering Plants Flower StructureActinomorphic Flower Examples
EasyOne-line MCQNew idea
Q106
Hind II always cuts DNA molecules at a particular point called recognition sequence and it consists of:
Biotechnology: Principles and Processes Restriction EnzymesHind II Cleavage Pattern
EasyOne-line MCQNew idea
Q107
Which of the following are required for the dark reaction of photosynthesis? A. Light B. Chlorophyll C. CO $_2$ D. ATP E. NADPH Choose the…
Photosynthesis in Higher Plants Calvin and Hatch-Slack CyclesC3 Reduction and Regen
EasyOtherNew idea
Q108
Match List I with List II List I | List II A. $Rhizopus$ | I. Mushroom B. $Ustilago$ | II. Smut fungus C. $Puccinia$ | III. Bread mould D.…
Biological Classification Kingdom FungiFungal Genera Classification
EasyMatch the listsNew idea
Q109
Lecithin, a small molecular weight organic compound found in living tissues, is an example of:
Biomolecules Biomolecule StructurePhospholipid Structure and Lecithin
EasyOne-line MCQNew idea
Q110
The capacity to generate a whole plant from any cell of the plant is called:
Strategies for Enhancement in Food Production Plant and Animal BreedingTotipotency and Tissue Culture
EasyOne-line MCQNew idea
Q111
Given below are two statements: Statement I : Chromosomes become gradually visible under light microscope during leptotene stage.…
Cell Cycle and Cell Division Meiotic Prophase IChiasmata Formation
MediumTwo statementsIdea asked in 2 papers
Q112
How many molecules of ATP and NADPH are required for every molecule of CO $_2$ fixed in the Calvin cycle?
Photosynthesis in Higher Plants Calvin and Hatch-Slack CyclesC3 Reduction and Regen
EasyOne-line MCQNew idea
Q113
Match List I with List II List I | List II A. Two or more alternative forms of a gene | I. Back cross B. Cross of F $_1$ progeny with…
Principles of Inheritance and Variation Mendelian InheritanceBack Cross vs Test Cross
EasyMatch the listsNew idea
Q114
List of endangered species was released by-
Biodiversity and Conservation Conservation StrategiesIUCN Red List Categories
EasyOne-line MCQNew idea
Q115
The equation of Verhulst-Pearl logistic growth is $\frac{dN}{dt} = rN\left[\frac{K-N}{K}\right]$ . From this equation, $K$ indicates:
Organisms and Populations Population AttributesCarrying Capacity (K)
EasyOne-line MCQNew idea
Q116
Identify the set of correct statements: A. The flowers of $Vallisneria$ are colourful and produce nectar. B. The flowers of waterlily are…
Sexual Reproduction in Flowering Plants Pollination MechanismsHydrophily Mechanisms and Traps
MediumOtherNew idea
Q117
Bulliform cells are responsible for
Anatomy of Flowering Plants Plant Tissues and AnatomyIsobilateral Leaf and Bulliform Cells
MediumOne-line MCQIdea asked in 2 papers
Q118
Which one of the following can be explained on the basis of Mendel's Law of Dominance? A. Out of one pair of factors one is dominant and…
Principles of Inheritance and Variation Mendelian InheritanceLaw of Dominance Postulates
MediumOtherNew idea
Q119
The cofactor of the enzyme carboxypeptidase is:
Biomolecules Biomolecule StructureEnzyme Prosthetic Groups
EasyOne-line MCQIdea asked in 3 papers
Q120
Which one of the following is not a criterion for classification of fungi?
Biological Classification Kingdom FungiMycelium Morphology
EasyOne-line MCQNew idea
Q121
Match List I with List II List I | List II A. Nucleolus | I. Site of formation of glycolipid B. Centriole | II. Organization like the…
Cell: The Unit of Life Nuclear OrganizationNucleolus and rRNA Synthesis
MediumMatch the listsIdea asked in 2 papers
Q122
Identify the part of the seed from the given figure which is destined to form root when the seed germinates.
Sexual Reproduction in Flowering Plants Embryo DevelopmentGrass Embryo Diagram Labeling
MediumFigure-basedNew idea
Q123
In the given figure, which component has thin outer walls and highly thickened inner walls?
Anatomy of Flowering Plants Plant Tissues and AnatomyEpidermal, Ground and Vascular Tissue Systems
EasyFigure-basedIdea asked in 2 papers
Q124
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
Molecular Basis of Inheritance Transcription ProcessTranscription Unit Parts
EasyOne-line MCQNew idea
Q125
Given below are two statements: Statement I : Parenchyma is living but collenchyma is dead tissue. Statement II : Gymnosperms lack xylem…
Anatomy of Flowering Plants Plant Tissues and AnatomyParenchyma, Collenchyma and Sclerenchyma
MediumTwo statementsIdea asked in 3 papers
Q126
A pink flowered Snapdragon plant was crossed with a red flowered Snapdragon plant. What type of phenotype/s is/are expected in the progeny?
Principles of Inheritance and Variation Mendelian InheritanceExamples of Incomplete Dominance
MediumOne-line MCQNew idea
Q127
Inhibition of Succinic dehydrogenase enzyme by malonate is a classical example of:
Biomolecules Biomolecule StructureTemperature and Competitive Inhibition
EasyOne-line MCQIdea asked in 2 papersAsked the year before
Q128
Match List I with List II List I | List II A. $Clostridium$ $butylicum$ | I. Ethanol B. $Saccharomyces$ $cerevisiae$ | II. Streptokinase…
Microbes in Human WelfareMicrobe-Product Matching
MediumMatch the listsIdea asked in 5 papers
Q129
Spindle fibers attach to kinetochores of chromosomes during
Cell Cycle and Cell Division Mitotic DivisionKinetochore Structure and Function
EasyOne-line MCQIdea asked in 2 papers
Q130
Auxin is used by gardeners to prepare weed-free lawns. But no damage is caused to grass as auxin
Plant Growth and Development Plant Growth Regulators2,4-D as a Dicot Herbicide
EasyOne-line MCQNew ideaIdea asked in 2 papers
Q131
Tropical regions show greatest level of species richness because A. Tropical latitudes have remained relatively undisturbed for millions…
Biodiversity and Conservation Patterns and Estimates of BiodiversityLatitudinal Gradient of Diversity
MediumOtherNew idea
Q132
Given below are two statements: Statement I : Bt toxins are insect group specific and coded by a gene $cry$ IAc. Statement II : Bt toxin…
Biotechnology and its Applications Transgenic PlantsSpecific Cry Gene Targets
MediumTwo statementsNew idea
Q133
What is the fate of a piece of DNA carrying only gene of interest which is transferred into an alien organism? A. The piece of DNA would…
Biotechnology: Principles and Processes Cloning VectorsOrigin of Replication (ori)
MediumOtherIdea asked in 3 papers
Q134
These are regarded as major causes of biodiversity loss: A. Over exploitation B. Co-extinction C. Mutation D. Habitat loss and…
Biodiversity and Conservation Biodiversity LossComponents of the Evil Quartet
EasyOtherIdea asked in 2 papers
Q135
In a plant, black seed color (BB/Bb) is dominant over white seed color (bb). In order to find out the genotype of the black seed plant,…
Principles of Inheritance and Variation Mendelian InheritanceTest Cross Application
EasyOne-line MCQNew idea
Q136
Read the following statements and choose the set of correct statements: In the members of Phaeophyceae, A. Asexual reproduction occurs…
Plant Kingdom Algae ClassificationPhaeophyceae Structure
MediumOtherNew idea
Q137
Match List I with List II List I (Types of Stamens) | List II (Example) A. Monoadelphous | I. Citrus B. Diadelphous | II. Pea C.…
Morphology of Flowering Plants Flower StructureCohesion of Stamens
MediumMatch the listsNew idea
Q138
Spraying sugarcane crop with which of the following plant growth regulators, increases the length of stem, thus, increasing the yield?
Plant Growth and Development Plant Growth RegulatorsGibberellins in Sugarcane Production
EasyOne-line MCQIdea asked in 2 papers
Q139
Identify the correct description about the given figure:
Sexual Reproduction in Flowering Plants Pollination MechanismsInflorescence Adaptation in Wind Pollination
EasyFigure-basedNew idea
Q140
Which of the following are fused in somatic hybridization involving two varieties of plants?
Strategies for Enhancement in Food Production Plant and Animal BreedingSomatic Hybridisation
EasyOne-line MCQNew idea
Q141
Identify the step in tricarboxylic acid cycle, which does not involve oxidation of substrate.
Respiration in Plants TCA CycleGTP/ATP Synthesis
MediumOne-line MCQIdea asked in 2 papers
Q142
Match List I with List II List I | List II A. Robert May | I. Species-Area relationship B. Alexander von Humboldt | II. Long term…
Biodiversity and Conservation Patterns and Estimates of BiodiversityScientists and Biodiversity Concepts
MediumMatch the listsNew idea
Q143
Match List I with List II List I | List II A. Rose | I. Twisted aestivation B. Pea | II. Perigynous flower C. Cotton | III. Drupe D. Mango…
Morphology of Flowering Plants Flower StructureMarginal Placentation Example
MediumMatch the listsNew idea
Q144
Match List I with List II List I | List II A. GLUT-4 | I. Hormone B. Insulin | II. Enzyme C. Trypsin | III. Intercellular ground substance…
Biomolecules Biomolecule StructureFunction of GLUT-4
MediumMatch the listsNew ideaIdea asked in 2 papers
Q145
The DNA present in chloroplast is:
Cell: The Unit of Life Mitochondria and PlastidsChloroplast DNA Characteristics
EasyOne-line MCQNew idea
Q146
Given below are two statements: Statement I : In C $_3$ plants, some O $_2$ binds to RuBisCO, hence CO $_2$ fixation is decreased. Statement…
Photosynthesis in Higher Plants Calvin and Hatch-Slack CyclesPhotorespiration (C2)
MediumTwo statementsNew idea
Q147
Which of the following statement is correct regarding the process of replication in $E.coli$ ?
Molecular Basis of Inheritance DNA ReplicationPolymerase Directionality
EasyOne-line MCQNew idea
Q148
Match List I with List II List I | List II A. Frederick Griffith | I. Genetic code B. Francois Jacob & Jacque Monod | II.…
Molecular Basis of Inheritance DNA ReplicationSemi-conservative Model
EasyMatch the listsIdea asked in 2 papers
Q149
Match List I with List II List-I | List-II A. Citric acid cycle | I. Cytoplasm B. Glycolysis | II. Mitochondrial matrix C. Electron…
Respiration in Plants Glycolysis PathwayGlycolysis Site and Substrate
EasyMatch the listsNew idea
Q150
In an ecosystem if the Net Primary Productivity (NPP) of first trophic level is 100x (kcal m $^{-2}$ ) yr $^{-1}$ , what would be the GPP…
Ecosystem Energy Flow in EcosystemLindeman's 10 Percent Law
MediumNumericalNew idea

Zoology50 questions

27 easy23 medium0 hard

Q151
Match List I with List II List-I | List-II A. Fibrous joints | I. Adjacent vertebrae, limited movement B. Cartilaginous joints | II.…
Locomotion and Movement Skeletal JointsFibrous Joints
EasyMatch the listsIdea asked in 2 papers
Q152
Match List I with List II List-I | List-II A. Typhoid | I. Fungus B. Leishmaniasis | II. Nematode C. Ringworm | III. Protozoa D.…
Human Health and Disease Human Diseases, Cancer and Drug AbuseDiseases and Their Pathogens
EasyMatch the listsIdea asked in 5 papersAsked the year before
Q153
In both sexes of cockroach, a pair of filamentous structures called anal cerci are on:
Structural Organisation in Animals Cockroach AnatomyAnal Cerci Segment Origin
EasyOne-line MCQNew idea
Q154
Which of the following is not a component of Fallopian tube?
Human Reproduction Female Reproductive SystemFallopian Tube Anatomy
EasyOne-line MCQNew idea
Q155
Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The…
Human Reproduction Female Reproductive SystemHymen Characteristics
EasyTwo statementsNew idea
Q156
Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic…
Human Health and Disease Immunity and Lymphoid OrgansAutoimmune Disorders
MediumOtherIdea asked in 3 papers
Q157
Match List I with List II List-I (Sub Phases of Prophase I) | List-II (Specific Characters) A. Diakinesis | I. Synaptonemal complex…
Cell Cycle and Cell Division Meiotic Prophase ISequence of Prophase I Stages
EasyMatch the listsIdea asked in 2 papers
Q158
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo…
Evolution Origin of Life and Human EvolutionSequence of Human Evolution
EasyOtherNew idea
Q159
Match List I with List II List-I | List-II A. Expiratory capacity | I. Expiratory reserve volume + Tidal volume + Inspiratory reserve…
Breathing and Exchange of Gases Mechanism of BreathingPulmonary Capacities
EasyMatch the listsIdea asked in 3 papersAsked the year before
Q160
Match List I with List II List-I | List-II A. Pons | I. Provides additional space for Neurons, regulates posture and balance. B.…
Neural Control and Coordination Neural System and BrainMidbrain, Hindbrain and Brain Stem
EasyMatch the listsNew idea
Q161
Given below are two statements: Statement I: In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to…
Excretory Products and their Elimination Urine FormationDescending Limb Permeability
MediumTwo statementsNew ideaIdea asked in 2 papers
Q162
Which of the following is not a steroid hormone?
Chemical Coordination and Integration Endocrine Glands and Hormone ActionChemical Classes of Hormones
EasyOne-line MCQIdea asked in 3 papers
Q163
Match List I with List II List-I | List-II A. Pterophyllum | I. Hag fish B. Myxine | II. Saw fish C. Pristis | III. Angel fish D.…
Animal Kingdom Chordate ClassesComparison of Fish Classes
MediumMatch the listsIdea asked in 2 papers
Q164
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Molecular Basis of Inheritance Transcription ProcessPredicting mRNA from Template Strand
EasyOne-line MCQNew idea
Q165
Which of the following statements is incorrect?
Biotechnology: Principles and Processes Cloning VectorsBioreactors
MediumOne-line MCQIdea asked in 3 papers
Q166
Three types of muscles are given as a, b and c. Identify the correct matching pair along with their location in human body: Name of…
Structural Organisation in Animals Animal TissuesMuscle Tissue Classification
EasyFigure-basedNew idea
Q167
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
Evolution Natural SelectionFactors Disturbing Hardy-Weinberg Equilibrium
MediumOne-line MCQNew idea
Q168
Which of the following is not a natural/traditional contraceptive method?
Reproductive Health Contraceptive MethodsNatural Contraceptive Methods
EasyOne-line MCQNew idea
Q169
The following diagram showing restriction sites in E.coli cloning vector pBR322. Find the role of 'X' and 'Y' genes:
Biotechnology: Principles and Processes Cloning VectorsOrigin of Replication (ori)
MediumFigure-basedIdea asked in 3 papers
Q170
Match List I with List II List-I | List-II A. Lipase | I. Peptide bond B. Nuclease | II. Ester bond C. Protease | III. Glycosidic bond D.…
Biomolecules Biomolecule StructurePeptide Bond Formation
EasyMatch the listsIdea asked in 2 papers
Q171
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
Breathing and Exchange of Gases Oxygen Dissociation CurveAlveolar Conditions for Oxyhemoglobin
EasyOne-line MCQIdea asked in 3 papers
Q172
Match List I with List II List-I | List-II A. Common cold | I. Plasmodium B. Haemozoin | II. Typhoid C. Widal test | III. Rhinoviruses D.…
Human Health and Disease Human Diseases, Cancer and Drug AbuseDiseases and Their Pathogens
MediumMatch the listsIdea asked in 5 papersAsked the year before
Q173
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: Breast-feeding during…
Human Health and Disease Immunity and Lymphoid OrgansColostrum and IgA
EasyAssertion–reasonIdea asked in 3 papers
Q174
Match List I with List II List-I | List-II A. Non-medicated IUD | I. Multiload 375 B. Copper releasing IUD | II. Progestogens C. Hormone…
Reproductive Health Contraceptive MethodsIUD Classifications
EasyMatch the listsIdea asked in 3 papers
Q175
Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the…
Cell Cycle and Cell Division Mitotic DivisionSequence of Cell Cycle Phases
EasyOtherIdea asked in 3 papers
Q176
Match List I with List II List-I | List-II A. Pleurobrachia | I. Mollusca B. Radula | II. Ctenophora C. Stomochord | III. Osteichthyes D.…
Animal Kingdom Animal Kingdom: Basis of Classification and Non-chordatesDistinctive Structures of Phyla
MediumMatch the listsIdea asked in 4 papers
Q177
The flippers of the Penguins and Dolphins are the example of the:
Evolution Evidence for EvolutionAnalogous Organs in Animals
EasyOne-line MCQIdea asked in 2 papers
Q178
Match List I with List II List-I | List-II A. Axoneme | I. Centriole B. Cartwheel pattern | II. Cilia and flagella C. Crista | III.…
Cell: The Unit of Life Ribosomes and CytoskeletonCilia and Flagella Structure
EasyMatch the listsNew idea
Q179
Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D.…
Body Fluids and Circulation Cardiac CycleBundle of His Electrical Isolation
EasyOtherNew idea
Q180
The 'Ti plasmid' of Agrobacterium tumefaciens stands for:
Biotechnology: Principles and Processes Cloning VectorsTi Plasmid and T-DNA
EasyOne-line MCQIdea asked in 2 papers
Q181
Match List I with List II List-I | List-II A. Cocaine | I. Effective sedative in surgery B. Heroin | II. Cannabis sativa C. Morphine |…
Human Health and Disease Human Diseases, Cancer and Drug AbuseDrugs: Sources and Effects
MediumMatch the listsIdea asked in 2 papersAsked the year before
Q182
Match List I with List II List-I | List-II A. Down's syndrome | I. 11th chromosome B. α-Thalassaemia | II. 'X' chromosome C.…
Principles of Inheritance and Variation Sex Determination and Genetic DisordersMendelian Disorders and Their Loci
MediumMatch the listsIdea asked in 2 papers
Q183
Match List I with List II List-I | List-II A. α-1 antitrypsin | I. Cotton bollworm B. Cry IAb | II. ADA deficiency C. Cry IAc | III.…
Biotechnology and its Applications Transgenic PlantsSpecific Cry Gene Targets
MediumMatch the listsNew idea
Q184
Consider the following statements: A. Annelids are true coelomates B. Poriferans are pseudocoelomates C. Aschelminthes are acoelomates D.…
Animal Kingdom Animal Kingdom: Basis of Classification and Non-chordatesAcoelomate, Pseudocoelomate and Coelomate
EasyOtherNew ideaIdea asked in 2 papers
Q185
Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian…
Chemical Coordination and Integration Endocrine Glands and Hormone ActionPituitary Gland
MediumAssertion–reasonNew ideaIdea asked in 3 papers
Q186
Given below are two statements: Statement I: Mitochondria and chloroplasts are both double membrane bound organelles. Statement II: Inner…
Cell: The Unit of Life Mitochondria and PlastidsDouble-Membrane Organelle Grouping
MediumTwo statementsNew idea
Q187
Regarding catalytic cycle of an enzyme action, select the correct sequential steps: A. Substrate enzyme complex formation. B. Free enzyme…
Biomolecules Biomolecule StructureCatalytic Cycle of an Enzyme
MediumOtherNew idea
Q188
Given below are two statements: Statement I: Gause's competitive exclusion principle states that two closely related species competing for…
Organisms and Populations Population InteractionsGause's Principle Limiting Condition
MediumTwo statementsNew idea
Q189
Match List I with List II List-I | List-II A. Exophthalmic goiter | I. Excess secretion of cortisol, moon face, hyperglycemia B.…
Chemical Coordination and Integration Endocrine Glands and Hormone ActionEndocrine Disorders
EasyMatch the listsIdea asked in 5 papers
Q190
As per ABO blood grouping system, the blood group of father is B $^+$ , mother is A $^+$ and child is O $^+$ . Their respective genotype can be…
Principles of Inheritance and Variation Mendelian InheritanceABO Blood Group System
MediumOtherIdea asked in 2 papers
Q191
The following are the statements about non-chordates: A. Pharynx is perforated by gill slits. B. Notochord is absent. C. Central nervous…
Animal Kingdom Chordate ClassesFundamental Chordate Features
EasyOtherIdea asked in 6 papersAsked the year before
Q192
Match List I with List II related to digestive system of cockroach. List-I | List-II A. The structures used for storing of food. | I.…
Structural Organisation in Animals Cockroach AnatomyDigestive Tract Anatomy
MediumMatch the listsIdea asked in 2 papers
Q193
Choose the correct statement given below regarding juxta medullary nephron.
Excretory Products and their Elimination Urine FormationCortical vs Juxtamedullary Nephrons
MediumOne-line MCQIdea asked in 2 papersAsked the year before
Q194
Match List I with List II List-I | List-II A. P wave | I. Heart muscles are electrically silent. B. QRS complex | II. Depolarisation of…
Body Fluids and Circulation ElectrocardiogramP-Wave Interpretation
EasyMatch the listsIdea asked in 2 papers
Q195
Identify the correct option (A), (B), (C), (D) with respect to spermatogenesis.
Human Reproduction Male Reproductive SystemHormonal Regulation of Spermatogenesis
MediumFigure-basedNew idea
Q196
Match List I with List II List-I | List-II A. Unicellular glandular epithelium | I. Salivary glands B. Compound epithelium | II. Pancreas…
Structural Organisation in Animals Animal TissuesUnicellular vs. Multicellular Glands
MediumMatch the listsNew idea
Q197
Given below are two statements: Statement I: The cerebral hemispheres are connected by nerve tract known as corpus callosum. Statement II:…
Neural Control and Coordination Neural System and BrainMidbrain, Hindbrain and Brain Stem
EasyTwo statementsNew idea
Q198
Match List I with List II List-I | List-II A. Mesozoic Era | I. Lower invertebrates B. Proterozoic Era | II. Fish & Amphibia C. Cenozoic…
Evolution Origin of Life and Human EvolutionGeological Eras and Life Forms
MediumMatch the listsNew idea
Q199
Match List I with List II List-I | List-II A. RNA polymerase III | I. snRNP $_s$ B. Termination of transcription | II. Promotor…
Molecular Basis of Inheritance Transcription ProcessRNA Polymerase III Function
MediumMatch the listsIdea asked in 3 papersAsked the year before
Q200
Given below are two statements: Statement I: Bone marrow is the main lymphoid organ where all blood cells including lymphocytes are…
Human Health and Disease Immunity and Lymphoid OrgansPrimary and Secondary Lymphoid Organs
MediumTwo statementsNew ideaIdea asked in 3 papers

Questions from the official NEET UG papers published by NTA (CBSE before 2019). Topic and idea tags, difficulty and notes are Lumi’s.

Other papers

Every NEET paper, 2017 to 2026

← NEET 2023 NEET 2025 →

How is difficulty decided?

Each question is rated easy, medium or hard by how many steps and how much recall it needs. It is Lumi’s rating, not NTA’s, and it is the same scale for every year.

What is a “new idea”?

Inside each topic we tag the exact idea a question tests. A new idea is one that no earlier paper in our data had tested. The first year, 2017, has nothing to compare with.

Does this tell me what will come next year?

No. It shows weightage and patterns from past papers. Chapters and topics repeat; exact questions rarely do.

All NEET chapters

How the 2024 paper split

Physics

Chemistry

Biology

Versus 2023 and the ten-year average

Easy questions

Need a calculation

Use a figure

Statements, A–R, match

What came back, and what was new

Questions whose … had appeared before

Questions testing a new idea, by year

Same idea as the year before

Which chapters got more, and which got less

More than usual

Less than usual, or skipped

All 76 chapters asked

Busiest topics in 2024

Question format

What the question tests

What 2024 asked, and its history

All 200 questions of NEET 2024

Every NEET paper, 2017 to 2026