NEET UG · Biology · Molecular Basis of Inheritance

Transcription Process: NEET previous year questions

15 questions in ten years of NEET, in 8 of 10 papers. Pattern: Every year. Here is how it is asked and which ideas come back.

Asked in 10 years: 15; about 1.4 per paper
Years asked: 8/10; last asked 2026
Chance of a question next paper: 84%; historical rate, how we compute it
Weighted estimate: 1.5; model; history: 1.4 a paper on average, typically 0–3

Key findings

01
Asked in 8 of 10 papers, 15 questions in all: #34 of 204 topics by ten-year total. It comes back every 1.3 years on average.
02
85% of its questions since 2018 tested an idea never asked before; 1 repeated an idea from the year before.
03
The most repeated idea is RNA Polymerase III Function, asked 3 times (2021, 2023, 2024), usually as “identify role of a polymerase”.
04
NEET has asked 11 of the 89 ideas in this topic; 67 have never been asked, directly or indirectly.
05
Mostly asked as one-line MCQ (87%); 47% easy, 0% hard, and up from 1.2 to 1.9 questions a paper since 2024.

Questions per year

Up to 2023: 1.2; per paper
Since 2024: 1.9; +0.7
Usual gap: 1.3 yrs; between papers asking it
Swing: ±0.9; questions, year to year

Revise first

RNA Polymerase III Function (2021 2023 2024); RNA Polymerase II Function (2026); Post-Transcriptional Mods (2025)

How it is asked

Difficulty, format and skill

Across all 15 questions on Transcription Process since 2017.

Difficulty

QUESTIONS

Easy7 · 47%
Medium8 · 53%
Hard0 · 0%

Format

One-line MCQ · 13 Q87%
Other · 1 Q7%
Match the lists · 1 Q7%

Skill tested

Recall · 11 Q73%
Application · 4 Q27%

Repeats

New idea, or one asked before?

Each column is a paper. Blue questions tested an idea NEET had not asked before; navy ones went back to an idea from an earlier paper. 2017 is the first paper, so everything in it counts as new.

’17’18’19’20’21’22’23’24’25’26

Idea asked for the first time
Idea asked in an earlier paper

Coverage of the topic

NEET has asked 11 of the 89 ideas in this topic. 67 have never been asked yet.

111167

Asked directly11 · 12%
Touched inside another question11 · 12%
Never asked67 · 75%

Ideas come from Lumi’s syllabus map of NCERT. A never-asked idea is not a safe skip: most new questions come from exactly these.

Drill down

Idea, year, question

Every idea NEET tested in this topic, with its ten papers. Open one to read the questions.

ideaAskedShareYears’17’18’19’20’21’22’23’24’25’26

Repeated3 · 20%20%3/10
- 2024 · Q199
  Match List I with List II List-I | List-II A. RNA polymerase III | I. snRNP $_s$ B. Termination of transcription | II. Promotor…
  mediumMatch the listsAsked the year before
- 2023 · Q113
  What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
  mediumOne-line MCQ
- 2021 · Q149
  What is the role of RNA polymerase III in the process of transcription in eukaryotes ?
  mediumOne-line MCQNew idea
2 · 13%13%1/102
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10
1 · 7%7%1/10

Squares are the ten papers, 2017 to 2026; darker means more questions. Share is of the level above.

Ideas

Every idea inside this topic

12 different ideas were tested; 2 came more than once. Transcription Unit Parts is the foundation for 66 other ideas in the syllabus.

RNA Polymerase III Function3×
identify role of a polymerase
One-line MCQ · 6% next · foundation for 4
Initiation/Elong/Term2×
true statement selection on transcription
One-line MCQ · 6% next · foundation for 28
RNA Polymerase II Function1×
identify enzyme function
One-line MCQ · 6% next · foundation for 1
Post-Transcriptional Mods1×
count correct statements on transcription
Other · 6% next · foundation for 9
Rho Factor Function1×
identify factor for a step
One-line MCQ · 6% next
Predicting mRNA from Template Strand1×
numerical
One-line MCQ · 6% next
Transcription Unit Parts1×
identify regions of transcription unit
One-line MCQ · 6% next · foundation for 66
Deducing Coding Strand Sequence1×
deduce coding strand from mrna
One-line MCQ · 4% next
Local Unwinding by RNA Polymerase1×
identify enzyme for a molecular step
One-line MCQ · 4% next
Deriving mRNA from Coding Strand1×
predict mrna from coding strand sequence
One-line MCQ · 4% next
Relative Abundance of RNA Types1×
order/ranking of property
One-line MCQ · 4% next
Spliceosome Mechanism1×
identify group lacking a feature
One-line MCQ · 4% next · foundation for 3

Idea	Times	Format	Chance next	Foundation for
RNA Polymerase III Functionidentify role of a polymerase	3	One-line MCQRecall	6%	4 ideas
Initiation/Elong/Termtrue statement selection on transcription	2	One-line MCQRecall	6%	28 ideas
RNA Polymerase II Functionidentify enzyme function	1	One-line MCQRecall	6%	1 ideas
Post-Transcriptional Modscount correct statements on transcription	1	OtherApplication	6%	9 ideas
Rho Factor Functionidentify factor for a step	1	One-line MCQRecall	6%	–
Predicting mRNA from Template Strandnumerical	1	One-line MCQApplication	6%	–
Transcription Unit Partsidentify regions of transcription unit	1	One-line MCQRecall	6%	66 ideas
Deducing Coding Strand Sequencededuce coding strand from mrna	1	One-line MCQApplication	4%	–
Local Unwinding by RNA Polymeraseidentify enzyme for a molecular step	1	One-line MCQRecall	4%	–
Deriving mRNA from Coding Strandpredict mrna from coding strand sequence	1	One-line MCQApplication	4%	–
Relative Abundance of RNA Typesorder/ranking of property	1	One-line MCQRecall	4%	–
Spliceosome Mechanismidentify group lacking a feature	1	One-line MCQRecall	4%	3 ideas

Chance next is the historical rate at which an idea with this record came back in the following paper. It is low for every idea, which is why learning the topic beats memorising past questions. All repeated ideas

Every question

Transcription Process questions, year by year

The opening words of each question as it appeared in the official paper, with the idea it tested.

NEET 20261 question

Q167
Which of the following enzymes synthesizes precursor mRNA ?
Idea: RNA Polymerase II Function
New ideaEasyOne-line MCQ

NEET 20252 questions

Q129
Which of the following are the post-transcriptional events in an eukaryotic cell? A. Transport of pre-mRNA to cytoplasm prior to splicing.…
Idea: Post-Transcriptional Mods
New ideaMediumOther
Q174
Which factor is important for termination of transcription?
Idea: Rho Factor Function
New ideaEasyOne-line MCQ

NEET 20243 questions

Q124
A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
Idea: Transcription Unit Parts
New ideaEasyOne-line MCQ
Q164
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'
Idea: Predicting mRNA from Template Strand
New ideaEasyOne-line MCQ
Q199
Match List I with List II List-I | List-II A. RNA polymerase III | I. snRNP $_s$ B. Termination of transcription | II. Promotor…
Idea: RNA Polymerase III Function
Asked last yearMediumMatch the lists

NEET 20232 questions

Q113
What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
Idea: RNA Polymerase III Function
MediumOne-line MCQ
Q193
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5'…
Idea: Deducing Coding Strand Sequence
New ideaMediumOne-line MCQ

NEET 20213 questions

Q138
Identify the correct statement.
Idea: Initiation/Elong/Term
New ideaMediumOne-line MCQ
Q149
What is the role of RNA polymerase III in the process of transcription in eukaryotes ?
Idea: RNA Polymerase III Function
New ideaMediumOne-line MCQ
Q174
Which is the “Only enzyme” that has “Capability” to catalyse Initiation, Elongation and Termination in the process of transcription in…
Idea: Initiation/Elong/Term
New ideaEasyOne-line MCQ

NEET 20201 question

Q67
Name the enzyme that facilitates opening of DNA helix during transcription.
Idea: Local Unwinding by RNA Polymerase
New ideaEasyOne-line MCQ

NEET 20181 question

Q161
AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA ?
Idea: Deriving mRNA from Coding Strand
New ideaEasyOne-line MCQ

NEET 20172 questions

Q111
Spliceosomes are not found in cells of :
Idea: Spliceosome Mechanism
MediumOne-line MCQ
Q140
Which of the following RNAs should be most abundant in animal cell ?
Idea: Relative Abundance of RNA Types
MediumOne-line MCQ

Questions from the official NEET UG papers published by NTA (CBSE before 2019). Topic and idea tags, counts and notes are Lumi’s.