NEET UG 2024 · Zoology · Question 164
NEET 2024 Zoology, question 164
Question 164 of the NEET 2024 paper (code T2) is a Zoology question from Molecular Basis of Inheritance. Its idea, Predicting mRNA from Template Strand, was asked only this once in NEET 2017–2026. The NTA final answer key gives option 3.
Updated 2026-10-08
Q164 · Zoology
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
- 15'AUGUACCGUUUAUAGGGAAGU3'
- 25'ATGTACCGTTTATAGGTAAGT3'
- 35'AUGUACCGUUUAUAGGUAAGU3'Official answer
- 45'AUGUAAAGUUUAUAGGUAAGU3'
Official answer: option 3 · NTA final answer key
Same idea
The only question on Predicting mRNA from Template Strand
No other NEET paper from 2017–2026 tested this exact idea.
Predicting mRNA from Template Strand: every question and how it was framed
The chapter
Molecular Basis of Inheritance in ten years of NEET
61 questions from 2017–2026, asked in 10 of 10 papers, about 5.8 a paper. Transcription Process alone had 15.